Ка 160 завод: Асфальтосмесительная установка «КА-160» — Колокшанский Агрегатный Завод

Содержание

Асфальтосмесительная установка «КА-160» — Колокшанский Агрегатный Завод

Основные составные части «КА-160»:

  1. Бункеры-дозаторы
  2. Сборочный транспортёр
  3. Барабан сушильный
  4. Комбинированная горелка
  5. Элеватор горячих минералов
  6. Виброгрохот, 5 фракций
  7. Бункер горячих минералов
  8. Бункер негабарита
  9. Устройство взвешивания
  10. Смесительное устройство
  11. Бункер готового асфальта
  12. Устройство очистки отходящих газов
  13. Элеватор пыли
  14. Ёмкость собственного заполнителя
  15. Ёмкость привозного заполнителя
  16. Установка обогрева битума
  17. Битумная ёмкость
  18. Приёмная ёмкость битума
  19. Ёмкость жидкого топлива
  20. Подача целлюлозной добавки
  21. Лестницы и помосты
  22. Площадки опорные
  23. Кабина управления

Основные технические характеристики «КА-160»

Наименование Показатели
1. Тип установки: Перемещаемая, быстромонтируемая, циклического действия
2. Производительность при 4% влажности минералов: 160 т/час
3. Установленная мощность: 350 кВт
4. Бункеры-дозаторы: 5 х 12,5 м3
5. Сушильный барабан: 4 х 11 кВт, 14 МВт
6. Виброгрохот, количество сит: 6
7. Бункер горячих минералов: 5 фракций, 25 т
8. Устройство очистки отходящих газов: Рукавные фильтры
9. Устройства взвешивания: Тензодатчики
10. Тип смесителя: Циклический
11. Максимальная масса замеса: 2.000 кг
12. Цикл одного замеса: 45 сек
13. Привод исполнительных механизмов: Электропневматический
14.
Система управления: Автоматическая с МСУ
15. Длина установки: 48.640 мм
16. Ширина установки: 24.600 мм
17. Высота установки: 22.235 мм

Предлагаем Вашему вниманию перемещаемую, быстромонтируемую асфальтосмесительную установку «КА-160», циклического действия, производительностью 160 т/час. В качестве основы при проектировании оборудования была взята установка «Глобал» фирмы «АММАНН». Выбор был сделан на основе 20 летнего опыта работы с асфальтосмесительными установками. Вертикальное расположение башни установки обеспечивает незначительные установочные габариты и большую экономию расхода электроэнергии при эксплуатации.

Наше оборудование спроектировано и изготовлено полностью в транспортном габарите и не требует дополнительных разрешений кроме вертикальных ёмкостей битума. По желанию Покупателя мы комплектуем асфальтосмесительные установки горизонтальными ёмкостями, которые имеют также габаритные транспортные размеры.

Наше предприятие на протяжении многих лет выпускает однотипное серийное оборудование, что позволило добиться высокого стабильного качества и надёжности. За весь период эксплуатации асфальтосмесительных установок (более 12 лет) нашими Покупателями не зафиксировано ни одного серьёзного отказа оборудования. Наши специалисты в постоянном контакте с эксплуатирующими организациями непрерывно совершенствуют выпускаемые асфальтосмесительные установки и дополняют их всем необходимым, чтобы соответствовать жёстким требованиям дорожной отрасли и наших Покупателей.

На всё оборудование имеется Декларация о соответствии Таможенного Союза, а также вся необходимая разрешительная документация для его эксплуатации. Производство сертифицировано по стандарту

ISO 9001. Несколько цехов с большим количеством обрабатывающих центров и станков с ЧПУ, а также собственное литейное производство, позволяют достичь высокого качества изготавливаемых узлов и агрегатов. Это в свою очередь обеспечивает надёжную и стабильную работу оборудования на долгие годы.

На все асфальтосмесительные установки предоставляется гарантия – 18 месяцев. Это позволяет 2 сезона эксплуатировать оборудование без дополнительных затрат, а при умеренной работе полностью его окупить за данный период.

Наше предприятие имеет специализированный сервисный центр, который осуществляет шеф-монтаж, пуско-наладочные работы, обучение персонала Покупателя, оперативно решает вопросы поставок запасных частей и обслуживания оборудования, используя собственный автотранспорт. Срок выезда специалиста составляет всего 1-3 дня, в зависимости от сложности отказа и места нахождения оборудования. Для удобства Покупателей, на предприятии ООО «Тельтосервис» в Москве, сформирован склад запасных частей и расходных материалов, откуда различными способами оперативно осуществляется их отгрузка.

Мы поставляем лучшее в Российской Федерации оборудование в соотношении цена-качество, которое соответствует всем основным требованиям наших Покупателей: надёжность, производительность, мобильность, экономичность, соответствие экологическим нормам, наличие сервисного центра.

За 15 лет на рынке
мы поставили 100 заводов.

Наши Клиенты — 19 областей РФ. Мы строим по всей России.

Входим в 10 лучших товаров года. Участвуем в выставках. Мы — надежный партнер!

Лучшее соотношение высокого качества и невысокой стоимости. Быстрая окупаемость.

Гарантия на запчасти и оборудование на протяжении 1,5 лет.

Лучшие тех. характеристики энергопотребления среди аналогов.

Европейские комплектующие: Моторы-редуктора «BAUER». Аппаратура «Kloeken-Moeller».

Оперативный выезд ремонтной бригады и ремонт установок в течении двух-трех дней.

Подробные технические характеристики «КА-160» — Колокшанский Агрегатный Завод

1. Базовая комплектация «КА-160»

1.1. Система предварительного дозирования, 5х12,5 м

3

Система предварительного дозирования включает в себя 5 бункеров-дозаторов вместимостью 12,5 м3, с датчиками наполнения, с частотным управлением и сборный конвейер с мотор-барабаном, собирающий материал под дозаторами и подающий его в сушильный барабан. На двух дозаторах установлены вибраторы для песка и отсева. Форма дозаторов позволяет гарантировано дозировать щебень без применения вибраторов. В комплект поставки входят: трапы, помосты, лестница, решётки негабарита для предотвращения попадания мусора и камней в процесс производства и воротники для увеличения объёма.

Количество бункеров: 5 шт
Объём бункеров: 5х12,5 м3
Тип питателей: ленточный, регулируемый
Производительность питателя: 120 т/час
Скорость ленты, регулируемая: 0,036-0,186 м/с
Мощность электродвигателя привода: 1,5 кВт
Сборный конвейер: ленточный
Производительность сборного конвейера: 160 т/час
Ширина ленты сборного конвейера: 650 мм
Длина ленты сборного конвейера: 61,6 м
Мощность электродвигателя привода: 7,5 кВт

1.

2. Барабан сушильный с комбин. горелкой, (МГ-14, 13,9 МВт)


Барабан сушильный непрерывного действия с противоточной системой сушки. Состоит из сушильного барабана на раме с кованными бандажами и утеплением, обшитого алюминием, приводных роликов, которые приводятся в движение

мотор-редукторами BAUER, Германия, по 11 кВт каждый и горелки собственного производства МГ-14 (или горелки «SAACKE», Германия, п. 2.3. опция).
Оператор с помощью преобразователя частоты управляет скоростью вращения барабана, максимально используя его КПД и сохраняя температуру отходящих газов постоянной. Для жидкого топлива поставляется ёмкость 25 м3, входит в базовую комплектацию. Для работы на газе горелка комплектуется газорегулировочной линией SAACKE, Германия, специальное оборудование, п. 3.2. (опция). Высокий КПД сушильного барабана за счёт эффективного расположения лопаток и качественного сгорания топлива. Точки измерения температуры находятся: на выходе из сушильного барабана (инфракрасный датчик), в секции для песка (термометр сопротивления), на выходе из смесителя (инфракрасный датчик). Контроль температуры отходящих газов осуществляется со стороны подачи материала в барабан и на входе в устройство пылеочистки.

Производительность при 4 % влажности минералов: 160 т/час
Диаметр барабана: 2.160 мм
Длина барабана: 8.000 м
Угол наклона барабана: 4,0 °
Мощность электродвигателей привода: 4 x 11 кВт
Мощность горелки: 1,75-13,9 МВт
Расход газа (MAX): 1.400 м3/час
Расход жидкого топлива (MAX): 1.180 кг/час

1.3. Элеватор горячих минералов

Элеватор вертикального типа, цепной, ковшовый предназначен для транспортировки горячего материала на грохот. Оборудован пластинчатой цепью и мотор-редуктором BAUER, Германия.

Объём ковшей элеватора с 50 % запасом. Натяжение осуществляется с помощью пружин. Верхняя часть элеватора со снимающейся крышкой, а также ревизионным люком для доступа персонала при техническом обслуживании. В месте выгрузки (сброса) материала установлена литая броня.

Производительность: 160 т/час
Мощность электродвигателя привода: 15,0 кВт

1.4. Грохот, 5 фракций, 2х7,5 кВт


Грохот линейного типа, двухвальный. В грохоте нет механических частей, работающих в горячей зоне (валов, подшипников, моторов), что позволяет повысить срок службы агрегата. Если грохот не используется, то возможно переключение в режим байпаса. В конструкции предусмотрена большая площадка для обслуживания грохота и замены сит. По желанию Покупателя грохот можно оборудовать специальной лебёдкой п. 3.4. (опция).

Тип грохота:
линейный, вибрационный
Количество дек: 5 шт
Ячейки сит (по заказу): 3,8 – 60 мм
Мощность электродвигателей привода: 2 x 7,5 кВт

1.

5. Бункер горячих минералов, 5 фракций, 25 т

Бункер горячих минералов общей вместимостью 25 тонн в пяти секциях, оборудован ротационными датчиками максимального уровня для сигнализации наполнения секций. Секция песка может использоваться в качестве байпаса. Если при отгрузке готового асфальта отсутствует автотранспорт или бункер готового асфальта заполнен, то запас материалов в бункере горячих минералов позволяет на 5-7 минут останавливать смеситель без снижения производительности предварительного дозирования.

Количество секций минералов: 5 шт
Бункер негабарита: 5,9 м3
Общая вместимость минералов: 21,0 м3
Секция песка: 9,5 м3
Секция 2: 3,2 м3
Секция 3: 2,7 м3
Секция 4: 2,8 м3
Секция 5: 2,8 м3

1.

6. Устройство взвешивания


Устройство взвешивания включает в себя автоматические высокоточные весы минерала, заполнителя, битума и целлюлозной добавки тензометрического действия. Тензодатчики установлены на демпферные прокладки. Это позволяет снизить влияние вибрации, возникающее при работе агрегатов, и осуществлять точное взвешивание компонентов. Разгрузка минералов и заполнителя из весов происходит с помощью двух заслонок с электропневматическим приводом. Весы для битума обогреваются электротеном. Заполнение весов битума осуществляется с помощью трёхходового крана с электропневматическим приводом. Подача битума в смеситель происходит самотёком при открытии клапана.

Объём весов минералов: 2,0 м3
Объём весов заполнителя: 0,34 м3
Объём весов битума: 0,24 м3
Объём весов целлюлозной добавки: 0,04 м3

1.

7. Устройство смесительное, 2.000 кг


Лопастной двухвальный смеситель циклического действия оборудован высококачественными износостойкими компонентами собственного литейного производства, что позволяет снизить расходы на его обслуживание и увеличить срок службы устройства в целом. Кубовидная форма и конструктивные особенности смесителя обеспечивают быстрое и высококачественное перемешивание всех необходимых компонентов. Результат – самые высокие показатели качества готовой смеси среди аналогичного оборудования. Данная характеристика подтверждается не только лабораторными исследованиями, но и эксплуатирующими организациями. Фактическая экономия связующих веществ в процессе производства асфальта до 5%! Затвор смесителя с электропневматическим приводом. Валы смесителя синхронизированы. Измерение температуры готовой смеси осуществляется с помощью инфракрасного датчика.

Масса одного замеса: 2.000 кг
Время одного замеса: 45 сек
Мощность электродвигателей привода: 2 x 30 кВт
Высота проезда под смесителем: 3,70 м

1.

8. Бункер готового асфальта с распред. устройством, 50 т


Бункер готового асфальта общей вместительностью 50 тонн с распределительным устройством с пневмоприводом, предназначен для хранения готовой асфальтовой смеси, а также дальнейшей её выгрузки с помощью обогреваемых затворов с пневмоприводами в автотранспорт. Бункер имеет две секции по 22,5 тонны для приготовления различных смесей и одну секцию на 5 тонн. Также имеется бункер негабарита вместимостью 8 т. Разгрузка бункера негабарита выведена из зоны выгрузки асфальта. Параметры контроля: имеются датчики контроля температуры и сигнализаторы готовности к разгрузке асфальта.

Количество секций: 3 шт
Общая вместимость: 50,0 т
Секция 1: 22,5 т
Секция 2: 22,5 т
Секция 3: 5,0 т

1.

9. Устройство пылеочистки, 90 кВт

Фильтрующее устройство включает в себя комбинированный рукавный фильтр с интегрированным предотделителем, пылесборником в корпусе и совместным выводом грубой и тонкой пыли. Фильтр собран в комплекте с дымососом, что позволяет снизить его стоимость и уменьшить срок монтажа. На вентиляторе дымососа установлен частотный преобразователь, что позволяет экономить значительное количество потребляемой электроэнергии при эксплуатации установки. Частотный преобразователь в автоматическом режиме отслеживает заданное значение разряжения в сушильном барабане и поддерживает его на необходимом уровне. При запуске дымосос потребляет всего около 5 кВт. В рабочем режиме около 45 кВт. Устройство пылеочистки оборудовано автоматической системой подачи воздуха из атмосферы при достижении предельного значения температуры отходящих газов перед фильтрами. Благодаря оригинальной конструкции рукавного фильтра Асфальтосмесительная установка «КА-160» соответствует требованиям СП 2. 2.2.1327-03 «Гигиенические требования к организации технологических процессов, производственному оборудованию и рабочему инструменту», гигиенических нормативов ГН 2.2.5.1313-3 «Предельно-допустимые концентрации (ПДК) вредных веществ в воздухе рабочей зоны». Эффективность пылеочистки составляет 99,8%.

Общая площадь фильтрующих элементов: 578 м2
Количество фильтрующих рукавов: 432 шт
Термостойкость фильтрующего полотна (пиковая): 180 °C
Температура отходящих газов не более: 150 °C
Концентрация пыли в отходящих газах: 0,015 г/м3
Производительность дымососа: 59.000 м3/час
Мощность электродвигателя привода: 90,0 кВт
Клапаны обдува: 4 шт
Мощность электродвигателей клапанов обдува: 4 х 0,37 кВт
Мощность привода шнека сборника пыли: 4,0 кВт

1.

10. Шнек подачи пыли в элеватор, наклонный 5,5 кВт

Шнек подаёт собственную пыль из пылесборника установки пылеочистки в элеватор пыли. Высокая надёжность в работе шнеков обеспечена их особенностями изготовления: шнеки без промежуточной опоры, с витой рабочей частью, Германия, и мотор-редуктором BAUER.

Диаметр шнека: 219 мм
Длина шнека: 6.400 мм
Мощность электродвигателя привода: 5,5 кВт

1.11. Элеватор пыли, 4,0 кВт

Элеватор пыли ленточный, ковшовый, вертикального типа с мотор-редуктором BAUER, Германия. Осуществляет подачу собственного заполнителя в бункер горячих материалов. Элеватор удобен в монтаже, обслуживании и надёжен в работе.

Производительность элеватора пыли: 35 т/час
Мощность электродвигателя привода: 4,0 кВт

1.

12. Ёмкость собственного заполнителя, 29 м3


Ёмкость собственного заполнителя вертикальная, круглого сечения с шиберами, аэрацией, фильтром, датчиками наполнения и сбросом. Уровень собственного заполнителя измеряется вращающимися датчиками максимального и минимального значения.

Объём ёмкости собственного заполнителя: 29,0 м3
Количество ёмкостей собственного заполнителя: 1 шт

1.13. Ёмкость привозного заполнителя, 37 м

3

Ёмкость привозного заполнителя вертикальная, круглого сечения, устанавливается сверху на ёмкость собственного заполнителя, с шиберами, аэрацией, фильтром и датчиками наполнения. Уровень привозного заполнителя измеряется надёжными ротационными датчиками с помощью системы управления. Привозной заполнитель подаётся с помощью наклонного шнека непосредственно в весы. Установлен рукавный фильтр сброса воздуха, 44 м2, с вибратором для закачки минерального порошка.

Объём ёмкости привозного заполнителя: 37,0 м3
Количество ёмкостей привозного заполнителя: 1 шт

1.14. Шнек подачи привозного заполнителя, наклонный, 5,5 кВт

Шнек подаёт минеральный порошок из ёмкости привозного заполнителя непосредственно в весы. Высокая надёжность в работе шнеков обеспечена их особенностями изготовления: шнеки без промежуточной опоры, с витой рабочей частью, Германия, и мотор-редуктором BAUER.

Производительность шнека: 35 т/час
Диаметр шнека: 273 мм
Длина шнека: 6.100 мм
Мощность электродвигателя привода: 5,5 кВт

1.15. Ёмкость битума вертикальная, 50 м

3


Ёмкость битума вертикального исполнения (или горизонтального, по желанию Покупателя) с утеплителем, обшита оцинкованным листом, обогрев термальным маслом. Дополнительно ёмкость можно оборудовать станцией закачки битума, 2 м3, с обогревом и насосом закачки с приводом 7,5 кВт, п. 2.5. (опция). Также по желанию Покупателя возможна поставка дополнительных ёмкостей битума п. 2.4. (горизонтальных или вертикальных) и ёмкости для хранения модифицированного битума с перемешивающими устройствами, п. 3.5. (опции).

Объём ёмкости битума: 50,0 м3
Количество ёмкостей битума: 2 шт

1.16. Установка косвенного обогрева битума,


с жидкотопливной горелкой LO 400

Представляет собой контейнер, внутри которого расположен котёл с базальтовым утеплителем. Высококачественная изоляция обеспечивает низкие потери тепла. Установка заправлена термальным маслом, может эксплуатироваться автономно. При монтаже или перевозке нужно только распределить масло по системе, а при демонтаже снова скачать её в ёмкость и можно передвигаться. Установка имеет высокий КПД за счёт трёхкратного прохода горячего воздуха через регистры. Большая площадь разогрева и объём теплоносителя. Полностью автономная система управления, контроля температуры и давления масла. Импортная жидкотопливная горелка UNIGAS, LO 400, Италия. В системе теплоносителя используются надёжные термостойкие шаровые краны, CAMOZZI, Италия. Имеется возможность замены жидкотопливной горелки LO 400 на газовую, NG-350, п. 3.1. (опция).

Мощность установки: 115 — 420 кВт
Объём теплоносителя: 220 л
Производительность насоса теплоносителя: 30 м3/час
Мощность привода насоса теплоносителя: 7,5 кВт
Объём ёмкости дизельного топлива: 500 л
Расход дизельного топлива (мах): 35 кг/час

1.

17. Битумный насос с трубопроводами, 7,5 кВт

Битумный насос предназначен для подачи битума в асфальтосмесительную установку по трубопроводам ДУ80, которые обогреваются термальным маслом.

Производительность битумного насоса: 30 м3/час
Мощность привода битумного насоса: 7,5 кВт

1.18. Компрессор, с дополнительным осушителем


Компрессор с дополнительным осушителем предназначен для подачи сжатого воздуха в пневмоцилиндры рабочих агрегатов асфальтосмесительной установки. Данная комплектация позволяет эксплуатировать установку при низких значениях температуры окружающей среды и резких перепадах.

Винтовой компрессор: ВК 20
Номинальное давление: 10 Бар
Производительность осушителя: 2,0 м3/мин
Мощность электродвигателя привода: 15,0 кВт

1.

19. Ёмкость дизельного топлива, с насосом и трубопроводами, 25 м3

Ёмкость предназначена для обеспечения основной горелки асфальтосмесительной установки жидким топливом. Оборудована насосом, трубопроводами, кранами и фильтром тонкой очистки. По желанию Покупателя возможна поставка дополнительных ёмкостей дизельного топлива, п. 2.6. (опция).

Объём ёмкости дизельного топлива: 25,0 м3
Производительность насоса: 42 л/мин
Мощность привода насоса: 1,1 кВт
Количество ёмкостей дизельного топлива: 1 шт

1.20. Лестницы и помосты для всей установки


Асфальтосмесительная установка «КА-160» оборудована всеми необходимыми лестницами и помостами для безопасного и беспрепятственного доступа ко всем основным узлам и агрегатам при монтаже, эксплуатации и техническом обслуживании оборудования.

1.21. Стойки опорные для башни


Опорные стойки для башни конструктивно рассчитаны с максимальным запасом нагрузки при полной загрузке асфальтосмесительной установки, обеспечивая свободный проезд автотранспорта для отгрузки готовых смесей асфальта.

1.22. Площадки опорные для основных узлов установки,


вместо бетонного фундамента


Опорные площадки входят в базовую комплектацию асфальтосмесительной установки. Благодаря данным площадкам нет необходимости изготавливать бетонные фундаменты. Это значительно сокращает время монтажа и демонтажа установки, позволяет Покупателю существенно сократить затраты на подготовку площадки, а также является неоспоримым преимуществом при переброске установки на новое место дислокации.

1.23. Кабина управления


Кабина управления разделена на две части. Одна часть с коммутационной аппаратурой, другая с рабочим местом для оператора. Кабина оборудована: рольставнями, для защиты от солнечных лучей и осадков; освещением, кондиционером, рабочим местом оператора, столом и стулом. Собственная программа управления разработана и используется в течение 15 лет более чем на 100 асфальтосмесительных установках в различных регионах России. Система управления отображает основные производственные процессы, простая и удобная для начинающих операторов, надёжная при непостоянной и интенсивной эксплуатации оборудования. Оператор может управлять установкой как в ручном, так и автоматическом режиме, выбрав необходимый заложенный рецепт, указав в задании выпуск необходимого количества выпускаемой смеси. В случае возникновения не штатной ситуации система автоматически переключается в режим «ОТКАЗ» и указывает оператору в каком месте произошёл сбой коммутационной аппаратуры.

1.24. Монтажный комплект

Монтажный комплект состоит из множества компонентов. Основные из них:
Комплект эксплуатационной документации;
Комплект ЗИП; набор инструментов;
Комплект пневмооборудования; комплект для масляной и топливной разводки;
Кабели, крепёж, кронштейны.

1.

25. Отделитель негабарита, (сбрасыватель)

Отделитель негабарита предназначен для удаления крупного минерала, а также различных крупных включений непосредственно со сборочного конвейера. Состоит из мотора-редуктора BAUER, Германия, сбрасывателя и крепежа.

Тип привода: мотор-редуктор
Мощность электродвигателя привода: 0,75 кВт

1.26. Станция закачки битума, с битумным насосом, обогреваемая, 2 м

3

Станция закачки предназначена для приёма и перекачки битума в битумные ёмкости не останавливая работу асфальтосмесительной установки. Оборудована обогревом термальным маслом и насосом закачки.

Объём станции закачки битума: 2,0 м3
Количество ёмкостей: 1 шт
Производительность битумного насоса: 30 м3/час
Мощность привода битумного насоса: 7,5 кВт

1.

27. Система подачи целлюлозной добавки, 7,5 кВт

Система подачи целлюлозной добавки предназначена для обеспечения подачи добавок при изготовлении щебеночно-мастичных асфальтовых смесей. Состоит из приёмного бункера-питателя с подающим вентилятором высокого давления и трубопровода подачи целлюлозных добавок непосредственно в весы, которые входят в базовую комплектацию.

Объём ёмкости приёмного бункера: 1,64 м3
Производительность вентилятора подачи добавки: 36-78 м3/мин
Давление вентилятора подачи добавки: 4,3-4,64 кПа
Мощность привода вентилятора подачи добавки: 7,5 кВт
Мощность привода шлюзового затвора: 0,75 кВт

2. Дополнительное оборудование (опции)

2.1. Дозатор, дополнительный, 12,5 м

3

По желанию Покупателя возможно оснащение установки дополнительными бункерами-дозаторами. В данном случае будет увеличен сборочный конвейер и подрамник. Наличие вибратора по желанию Покупателя.

Объём бункера: 12,5 м3
Тип питателя: ленточный, регулируемый
Производительность питателя: 120 т/час
Скорость ленты, регулируемая: 0,036-0,186 м/с
Мощность электродвигателя привода: 1,5 кВт
Количество бункеров: 1 шт

2.2. Замена комбинированной горелки МГ-14


на универсальную горелку SAACKE

Универсальная ротационная горелка SAACKE работает по принципу роторного высокоскоростного распыления топлива (дизельное топливо, печное топливо, нефть, мазут). Длина факела формируется вторичным воздухом. Это позволяет снизить требование к качеству топлива и обеспечивает его 100% сгорание. Для работы на газе горелка комплектуется газорегулировочной линией SAACKE, Германия, специальное оборудование, п. 3.2. (опция).

Мощность горелки: 1,75-14,0 МВт
Расход газа (MAX): 1.380 м3/час
Расход дизельного топлива (MAX): 1.170 кг/час
Расход мазута (MAX): 1.240 кг/час

2.3. Ёмкость битума вертикальная, дополнительная, 50 м

3

Ёмкость битума вертикального исполнения (или горизонтального, по желанию Покупателя) с утеплителем, обшита оцинкованным листом, обогрев термальным маслом. По желанию Покупателя возможна поставка дополнительных ёмкостей битума (горизонтальных или вертикальных) и ёмкости для хранения модифицированного битума с перемешивающими устройствами (опции). В данном случае установки косвенного обогрева битума, п. 1.16. достаточно для обогрева трёх дополнительных ёмкостей битума, объёмом по 50 м3. Если дополнительных ёмкостей битума будет больше чем три, то производится замена горелки LO 400 на более мощную, 550 кВт и добавляется дополнительный циркуляционный агрегат в установку косвенного обогрева битума, п. 3.3. (опция).

Объём ёмкости битума: 50,0 м3
Количество ёмкостей битума: 1 шт

2.4. Ёмкость дизельного топлива, с насосом


и трубопроводами, дополнительная, 25 м3

Ёмкость предназначена для обеспечения основной горелки асфальтосмесительной установки жидким топливом. Оборудована насосом, трубопроводами, кранами и фильтром тонкой очистки.

Объём ёмкости дизельного топлива: 25,0 м3
Производительность насоса: 42 л/мин
Мощность привода насоса: 1,1 кВт
Количество ёмкостей дизельного топлива: 1 шт

3.

Специальное оборудование (по желанию Покупателя)

3.1. Замена жидкотопл. горелки на газовую для установки


косвенного обогрева, 330 кВт

Для работы на площадке, оснащённой газовым снабжением, установка косвенного обогрева битума может комплектоваться газовой горелкой. В данном случае производится замена жидкотопливной горелки UNIGAS, LO 400 на газовую, NG-350.

Мощность горелки: 330 кВт
Расход газа (MAX): 35,0 м3/час

3.2. Газорегулировочная линия SAACKE, Германия

Для работы асфальтосмесительной установки на газе необходимо её оборудовать газорегулировочной линией, которая состоит из запорной заслонки и фильтра DN80, регулятора давления газа, шарового крана, манометров, предохранительного двойного электромагнитного клапана DN 125, реле давления газа MIN и MAX, устройства контроля герметичности газовых клапанов, кнопки аварийного отключения.
Газовый регулирующий участок 80-251 / 80-125 в блочном исполнении для расхода газа MAX 1500 м3/час, входное давление газа MAX 3,0-4,0 Бар с защитным участком в блочном исполнении DN 125 для расхода газа MAX 1500 м3/час с давлением MAX 500 мБар.

3.3. Дополнительный циркуляционный агрегат


установки косвенного обогрева битума

Дополнительный циркуляционный агрегат предназначен для перекачки масла косвенного обогрева в случае комплектации асфальтосмесительной установки дополнительными ёмкостями битума (общим объёмом, превышающим 200 м3). При этом производится замена горелки LO 400 на более мощную, 550 кВт.

Производительность насоса теплоносителя: 30 м3/час
Мощность привода насоса теплоносителя: 7,5 кВт

3.4. Лебёдка грохота для обслуживания и замены сит

Лебёдка предназначена для обслуживания грохота, замены, подъёма и опускания сит. Состоит из кран-балки, канатного грузоподъёмного механизма и привода.

Грузоподъёмность: 1.000 кг
Высота подъёма: 20 м

3.5. Ёмкость для хранения модифицированного битума, 47 м

3

Предназначена только для хранения модифицированного битума, горизонтального исполнения, с утеплителем, толщиной 100 мм, обшита оцинкованным листом, обогрев термальным маслом. В состав входят три смесителя, контур обогрева битума, датчики уровня и температуры, помосты и лестницы для обслуживания, пульт управления.

Объём ёмкости модифицированного битума: 47,0 м3
Объём теплоносителя: 435 л
Мощность приводов смесителей: 3х7,5 кВт
Скорость вращения привода смесителя: 750 об/мин
Количество ёмкостей модифицированного битума: 1 шт

3.

6. Ёмкость привозного заполнителя, дополнительная, 47 м3

Ёмкость привозного заполнителя вертикальная, круглого сечения, с шиберами, аэрацией, фильтром, датчиками наполнения, шнеками, элеватором, устанавливается на опоры в непосредственной близости от башни. Уровень привозного заполнителя измеряется надёжными ротационными датчиками с помощью системы управления. Ёмкость привозного заполнителя предназначена для складирования и хранения минерального порошка с последующей его подачей шнеками в элеватор, а затем в бочку привозного заполнителя 37 м3, п. 1.13. Установлен рукавный фильтр сброса воздуха, 44 м2, с вибратором для закачки минерального порошка.

Объём ёмкости привозного заполнителя: 47,0 м3
Количество ёмкостей привозного заполнителя: 1 шт

3.7. Склад привозного заполнителя, 2х47 м

3

Склад привозного заполнителя состоит из двух вертикальных ёмкостей, круглого сечения, с шиберами, аэрацией, фильтром, датчиками наполнения, шнеками, элеватором, устанавливается на опоры в непосредственной близости от башни. Уровень привозного заполнителя измеряется надёжными ротационными датчиками с помощью системы управления. Склад привозного заполнителя предназначена для складирования и хранения минерального порошка с последующей его подачей шнеками в элеватор, а затем в бочку привозного заполнителя 37 м3, п. 1.13. Установлен рукавный фильтр сброса воздуха, 44 м2, с вибратором для закачки минерального порошка.

Объём ёмкости привозного заполнителя: 47,0 м3
Количество ёмкостей привозного заполнителя: 2 шт

3.8. Устройство подачи вторичного асфальта

Устройство подачи вторичного асфальта предназначено для добавления холодного вторичного асфальта в смесительное устройство. В зависимости от требований максимальное количество подачи вторичного асфальта составляет 20% от замеса. Состоит из бункера-дозатора вторичного асфальта, ленточного конвейера, элеватора, промежуточного бункера-накопителя вторичного асфальта, весового конвейера, короба-затвора с пневмоприводом.

Объём бункера-накопителя: 12,5 м3
Ширина ленты сборочного конвейера: 650 мм
Скорость ленты: 1,25 м/с
Мощность электродвигателя привода конвейера: 4,0 кВт
Мощность электродвигателя привода элеватора: 15,0 кВт

3.9. Устройство подачи адгезионных добавок

Устройство подачи адгезионных добавок состоит из ёмкости для адгезионных добавок с дозирующим насосом, запорной арматурой и пультом управления, производительностью 6 т/ч (рецептура подачи дозирующего насоса составляет 0,1-0,5% 0,2-1,0% от общего объёма подачи битума).
Ниже краткое описание работы устройства подачи адгезионных добавок:
В трубопровод, по которому битум подаётся на весы АБЗ, вставляется специальный участок – так называемый статический миксер, предназначенный для эффективного перемешивания проходящего через него потока битума. В начало этого участка в заданной пропорции к битуму подаётся адгезионная присадка. Таким образом, при движении битума к весам он проходит через статический миксер и хорошо перемешивается с присадкой. Главным достоинством этого способа в отличие от остальных, является очень высокий коэффициент равномерности распределения присадки по всему объёму битума. Основные преимущества данного способа подачи добавки в том, что отпадает необходимость в дополнительной ёмкости для хранения битума с адгезионной присадкой, высокая гибкость производства (оператор решает сам добавлять или не добавлять присадку одним нажатием кнопки), низкое энергопотребление.
Оборудование обеспечивает высокую точность дозировки. Введение в битум адгезионной добавки способствует повышению его сцепления с каменными материалами. Это позволяет повысить водостойкость и морозостойкость асфальтобетона. Наряду с твёрдостью входящих в состав асфальтобетона минеральных материалов, адгезионные добавки влияют на износостойкость. Адгезионные добавки облегчают распределение связующего вещества по поверхности каменного материала. Результатом является уменьшение количества непокрытых частиц и улучшение консистентности смеси, что облегчает уплотнение.

Шеф-монтаж, пусконаладочные работы,


инструктаж персонала Покупателя

После выполнения Покупателем подготовительных работ по подготовке площадки, Продавец приступает к шеф-монтажу. Шеф-монтаж производится в течение 30 календарных дней, при условии выполнения Покупателем всех необходимых требований для проведения монтажа. После окончания шеф-монтажа производится пуско-наладка оборудования, пробный запуск в сухом режиме и выпуск первой смеси асфальта. Завершением данных работ является обучение персонала Покупателя управлением установкой, инструктаж по эксплуатации и техническому обслуживанию оборудования. Для осуществления шеф-монтажа завод-изготовитель предоставляет 2 специалистов монтажников. В течение всего времени пребывания на площадке, Покупатель обеспечивает за свой счёт размещение в гостинице, питание и транспорт на месте для специалистов завода-изготовителя.

Транспортировка до места эксплуатации

Транспортировка асфальтосмесительной установки производится частями, готовыми узлами. Мы формируем последовательную отгрузку оборудования с максимальной загрузкой каждой машины, с учётом разрешённой массы, чтобы минимизировать транспортные расходы для Покупателя и максимально эффективно использовать рабочую площадку при монтаже.

АБЗ КА-160

Предлагаем Вашему вниманию перемещаемую, быстромонтируемую асфальтосмесительную установку «КА-160», циклического действия, производительностью 160 т/час. В качестве основы при проектировании оборудования была взята установка «Глобал» фирмы «АММАНН». Выбор был сделан на основе 20 летнего опыта работы с асфальтосмесительными установками. Вертикальное расположение башни установки обеспечивает незначительные установочные габариты и большую экономию расхода электроэнергии при эксплуатации.

Наше оборудование спроектировано и изготовлено полностью в транспортном габарите и не требует дополнительных разрешений кроме вертикальных ёмкостей битума. По желанию Покупателя мы комплектуем асфальтосмесительные установки горизонтальными ёмкостями, которые имеют также габаритные транспортные размеры.

Наше предприятие на протяжении многих лет выпускает однотипное серийное оборудование, что позволило добиться высокого стабильного качества и надёжности. За весь период эксплуатации асфальтосмесительных установок (более 12 лет) нашими Покупателями не зафиксировано ни одного серьёзного отказа оборудования. Наши специалисты в постоянном контакте с эксплуатирующими организациями непрерывно совершенствуют выпускаемые асфальтосмесительные установки и дополняют их всем необходимым, чтобы соответствовать жёстким требованиям дорожной отрасли и наших Покупателей.

На всё оборудование имеется Декларация о соответствии Таможенного Союза, а также вся необходимая разрешительная документация для его эксплуатации. Производство сертифицировано по стандарту ISO 9001. Несколько цехов с большим количеством обрабатывающих центров и станков с ЧПУ, а также собственное литейное производство, позволяют достичь высокого качества изготавливаемых узлов и агрегатов. Это в свою очередь обеспечивает надёжную и стабильную работу оборудования на долгие годы.

Наше предприятие имеет специализированный сервисный центр, который осуществляет шеф-монтаж, пуско-наладочные работы, обучение персонала Покупателя, оперативно решает вопросы поставок запасных частей и обслуживания оборудования, используя собственный автотранспорт. Срок выезда специалиста составляет всего 1-3 дня, в зависимости от сложности отказа и места нахождения оборудования. Для удобства Покупателей, на предприятии ООО «СПЕЦТЕХМАШ» в Москве, сформирован склад запасных частей и расходных материалов, откуда различными способами оперативно осуществляется их отгрузка.

Мы поставляем лучшее в Российской Федерации оборудование в соотношении цена-качество, которое соответствует всем основным требованиям наших Покупателей: надёжность, производительность, мобильность, экономичность, соответствие экологическим нормам, наличие сервисного центра.

КОМПЛЕКТАЦИЯ, СТОИМОСТЬ И УСЛОВИЯ ПОСТАВКИ
Базовая комплектация асфальтосмесительной установки «КА-160» 
 Наименование составных частей установки «КА-160»  Кол-во
 Система предварительного дозирования, 5х12,5 м3  1
 Барабан сушильный с комбинированной горелкой, 4х11 кВт  1
 Элеватор горячих минералов, 15 кВт  1
 Грохот, 5 фракций, 2х7,5 кВт  1
 Бункер горячих минералов, 5 фракций, 25 т  1
 Устройство взвешивания, 2,0 м3 / 0,34 м3 / 0,24 м3 / 0,04 м3  1
 Устройство смесительное, 2000 кг, 2х30 кВт  1
 Бункер готового асфальта, 22. 5 / 22,5 / 5,0, негабарит 8,0 т  1
 Устройство пылеочистки, 90 кВт  1
 Шнек подачи пыли в элеватор, наклонный, 5,5 кВт  1
 Элеватор пыли, 4 кВт  1
 Ёмкость собственного заполнителя, 29 м3  1
 Ёмкость привозного заполнителя, 37 м3  1
 Шнек подачи привозного заполнителя, наклонный, 5,5 кВт  1
 Ёмкость битума вертикальная (горизонтальная), 50 м3  2
 Установка косвенного обогрева битума, жидкотопливная  1
 Битумный насос с трубопроводами, 7,5 кВт  1
 Компрессор с доп. осушителем, пневморазводка  1
 Ёмкость Д/Т с насосом и трубопроводами, 25 м3  1
 Лестницы и помосты для всей установки  1
 Стойки опорные для башни  1
 Площадки опорные для основных узлов установки  1
 Кабина управления (пультовая)  1
 Монтажный комплект, крепёж, кабель  1
 Отделитель негабарита, (сбрасыватель)  1
 Станция закачки битума с насосом и обогревом, 2 м3
 Система подачи целлюлозной добавки, 7,5 кВт  1
 Стоимость установки «КА-160» в базовой комплектации:

 69. 240.000,00

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

Срок поставки

Срок поставки оборудования зависит от загруженности производства и составляет в среднем 12 недель с момента поступления авансового платежа. Срок поставки может быть сокращён до 2 недель, при условии наличия основных компонентов оборудования на нашем складе. Информацию о наличии оборудования уточняйте по телефонам, указанным в контактах.

Условия оплаты

Оплата производится в следующем порядке:

  • 45%       после согласования комплектации оборудования и подписания договора;
  • 50%       после сообщения о готовности оборудования к отгрузке;
  • 5%         после завершения шефмонтажа, пусконаладочных работ и инструктажа персонала Покупателя.

 Гарантия

На асфальтосмесительную установку предоставляется гарантия сроком 18 месяцев с момента отгрузки оборудования с завода-изготовителя, но не более 12 месяцев с момента ввода в эксплуатацию. Гарантия не распространяется на детали и комплектующие изделия подверженные естественному износу, зависящему от интенсивности использования оборудования, а также от условий его эксплуатации.

Шефмонтаж, пусконаладочные работы, инструктаж персонала Покупателя

После выполнения Покупателем подготовительных работ по подготовке площадки, Продавец приступает к шефмонтажу. Шефмонтаж производится в течение 30 календарных дней, при условии выполнения Покупателем всех необходимых требований для проведения монтажа. После окончания шефмонтажа производится пуско-наладка оборудования, пробный запуск в сухом режиме и выпуск первой смеси асфальта. Завершением данных работ является обучение персонала Покупателя управлением установкой, инструктаж по эксплуатации и техническому обслуживанию оборудования. Для осуществления шефмонтажа завод-изготовитель предоставляет 2 специалистов монтажников.

Транспортировка до места эксплуатации

Транспортировка асфальтосмесительной установки производится частями, готовыми узлами. Мы формируем последовательную отгрузку оборудования с максимальной загрузкой каждой машины, с учётом разрешённой массы, чтобы минимизировать транспортные расходы для Покупателя и максимально эффективно использовать рабочую площадку при монтаже.

 

 

 

 

 

Журнал: “Транспортная стратегия XXI век” статья: КА-160 – Асфальтосмесители России №1

Генеральный директор ООО «Колокшанский агрегатный завод» Владимир Кравченко

 

Учредитель ООО «Колокшанский агрегатный завод» Алексей Мельников

 

 

С 2003 года ООО «Колокшанский агрегатный завод» проектирует и выпускает асфальтосмесительные установки, а также производит реконструкцию и ремонт асфальтосмесителей различных производителей на территории России.

 

 

 

ИСТОРИЯ СОЗДАНИЯ

 

Свою работу предприятие начало с конца 80-х годов, занимаясь обслуживанием зарубежных установок «Вибау», «Виртген», «Амманн», «Бенингхофен». Со временем мы приняли решение выпускать собственные узлы, запасные части для немецких, финских и других установок, так как заказы «на стороне» часто приводили к браку и потере средств. А повлиять на качество работ чужого производства не предоставлялось возможным. В 2002 году нами были произведены: дозаторы, транспортеры, сушильные барабаны, элеваторы, шнеки, грохота, фильтры, воздуховоды, промежуточные бункеры, скиповые пути, установки косвенного обогрева, битумные емкости. И, конечно, большое количество более мелких деталей.

Так и пришла идея создать свою асфальтосмесительную установку. В 2003 году мы ее спроектировали, в 2004 выпустили первый образец, и в 2005 году первая установка КА-160 заработала. В этом году, отмечая 10-летний юбилей с момента первого проекта, можно смело сказать, что установка себя хорошо зарекомендовала, выпустила большое количество асфальта – больше миллиона тонн, а одна из них до сих пор еще работает в Домодедово.

Кроме выпуска своих установок мы до сих пор занимаемся реконструкцией уже существующих. Мы не только выпускаем запчасти к ним, но и полностью переделываем некоторые технологические узлы, ставим наши тканевые фильтры, электронику, сенсорное управление. На данный момент реконструировано около сотни заводов. Три из них почти полностью переоборудованы под наши установки. Старые узлы заменяем нашими, и постепенно завод уходит совсем и появляется наш. Это растянуто на несколько лет, но клиенту это выгодно.

 

 

МОДЕРНИЗИРОВАННЫЙ АНАЛОГ

 

У нас накопился определенный опыт, когда мы занимались обслуживанием различных импортных асфальтосмесителей: итальянских, немецких, французских, финских. Соответственно, с учетом европейского опыта мы попытались выпустить свою. Все чертежи разрабатывали сами, взяли форму и технологический процесс, но при этом привнесли в установку много собственных разработок. Например, для европейцев не очень важен габарит при транспортных перевозках. Разрешенный транспортный габарит в Европе – три метра по ширине и четыре с половиной по высоте. А для России он очень важен, поэтому основной задачей было переработать установку так, чтобы она уложилась в разрешенный транспортный габарит. В результате появилась возможность быстро и комфортно ее перевозить.

 

Потом пришла мысль поставить асфальтосмеситель КА-160 на металлические опоры, потому что качество производства бетонных площадок, которые нам предлагает заказчик под установку, оставляет желать лучшего: невозможно установить оборудование. Мы пришли к выводу, что лучше понесем затраты и издержки в производстве, но зато во время монтажа нам будет гораздо легче. В результате установка КА-160 получилась достаточно мобильной и быстро перевозимой в любую точку страны; ее можно собрать-разобрать в течение недели.

 

 

ЭНЕРГОСБЕРЕЖЕНИЕ И ЭРГОНОМИЧНОСТЬ

 

Для своей установки КА-160 мы разработали оригинальную кабину оператора. У немцев принято делать кабину оператора с электрическими шкафами. В любой момент он может дверцу открыть, что-то там наладить, но иногда это очень опасно. Неудобно. Кабину оператора мы разделили на две части. Все разрабатывали по-своему, вычисляли все габариты. Очень много вынесли оборудования из кабины на внешние площадки или узлы, в результате кабина оператора получилась достаточно просторной, с кондиционером.

В этом году было принято решение все делать на разъемах. Раньше были провода, которые электрики собирали, соединяли. В этом году, пойдя на дополнительные издержки, мы увеличить мобильность. Приобрели импортные разъемы. Теперь не требуется высококвалифицированных электриков для сборки.

Также стараемся сделать установку энергосберегающей, особенно в пересчете на тонну произведенного материала. В несколько больших узлов, которые работают на мощных двигателях, поставили частотные приводы, которые сами по себе дают большую экономию. Поэтому вместо 90 кВт при запуске установка потребляет 3–4 кВт. Разница очень ощутимая. Но для этого нам опять же пришлось пойти на дополнительные расходы, чтобы клиент чувствовал, что он экономит с нашим оборудованием. Кроме того, это помогает автоматизировать работу сушильного барабана.

Помимо этого, у нас оснащенность выше, чем у зарубежных аналогов. Решетки, трапы, площадки, емкость для приема битума – это все стоит денег и у импортных компаний идет как дополнительные опции за дополнительные деньги. В нашем варианте все это уже включено в установку. Завод получается под ключ. К тому же у нас стоит комбинированная горелка – газовая и жидкотопливная. Покупатель может быстро переходить с одного вида топлива на другое.

При работе образуется большое количество пыли – около 40 тонн. Мы утилизируем ее с помощью нашего оборудования. Установка КА-160 экологически чистая, если посмотреть со стороны, там только пар небольшой идет независимо от того, какой вид топлива используется. Там очень качественная горелка. Она тоже дорогая, но мы опять-таки идем на это, потому что понимаем, что претензий к ней не будет. Горелка немецкая, но мы все равно отдельные технологические моменты в ней переделываем. Сгорание материалов в ней очень высокое, поэтому не догоревших углеродов в ней практически нет.

 

 

Заслуженный авторитет

 

Из практики следует, что те, кто покупает у нас одну установку, через какое-то время покупают еще. Данные показатели вызваны тем, что по стоимости наше оборудование в 2,5 раза дешевле немецкого, а по качеству и уровню ничуть не уступает. Многие предприятия уже отказываются от китайского оборудования, так как на территории России у них не предусмотрено обслуживание и нет складов запасных частей. Помимо этого, возникает ряд проблем в эксплуатации, нередки случаи, когда, все-таки приобретя китайские асфальтосмесительные установки, обращаются к нам за помощью. Например, грохот оснащен ситами, которые сортируют щебень на пять фракций. Китайцы положили сетки, закрепили их на болты, и у них грохот не работает. Люди приходят к нам и спрашивают: «Как он должен работать?». Мы говорим: «Пружинки должны стоять. Пружинки немецкие, стоят полмиллиона». «Делайте!» – отвечают они, потому что податься больше некуда. Китайцы продали – и все, а дальше это уже проблема предприятия.

В работе мы предпочитаем отечественный металл, к счастью, в России его достаточно и по объемам, и по качеству. В основном при выполнении работ используется металл «Северстали»: у них высокое качество, ровный металл. Что касается иностранного метала, с китайским мы не работаем, а европейский не соответствует цене/качеству из-за перевозок. В частях, где большие требования к износу, используется финский металл, но в небольшом количестве. Мотор-редукторов у нас отечественных хороших просто нет. Порядка 30% себестоимости у нас комплектация импортная: это электроника, контроллеры, некоторые цепи, транспортерные ленты.

 

Есть одно небольшое предприятие в Сибири по производству асфальтосмесительных установок, но оно никакой конкуренции нам в европейской части России не составляет.

В любом случае все эти издержки не сразу, конечно, но оправдывают себя. Это требует времени, чтобы заказчик поработал и на нашем оборудовании, и на аналогах. Прошло почти десять лет, как наши установки КА-160 работают, и люди начинают понимать их преимущества. Например, Самара уже купила двенадцать установок в один город. Рязань первую установку купила, через год вторую, еще через год третью, потом четвертую. В октябре у нас будет выходить юбилейная 50-я машина.

 

 

ОБСЛУЖИВАНИЕ – ДВИГАТЕЛЬ ТОРГОВЛИ

 

У любой машины бывают поломки, не исключение и наше оборудование. Но в основном это происходит из-за импортных комплектующих, на которые мы никак не может повлиять. Сервисное обслуживание у нас работает четко, как часы: все комплектующие, все запасные части у нас всегда на складе есть, а в силу удобного географического расположения сотрудники сервисной службы оперативно прибывают на место для ремонтных работ.

Перевозкой установок мы также занимаемся сами, чтобы исключить проблемы при транспортировке. У нас четыре «Вольво». Хорошие машины покупали специально, из расчета, что доставляем в любые регионы и на любое расстояние. К тому же мы знаем уже, как грузить, как лучше машину поставить. Собственная служба доставки удобней. По ГЛОНАССу мы видим, где наши машины, по какому маршруту идут, как удобней доставить.

 

 

ОПТИМАЛЬНЫЙ АСФАЛЬТОСМЕСИТЕЛЬ

 

В своей работе дорожники используют установки меньшей мощности, однако есть ряд проблем, возникающих при эксплуатации: во-первых, при хорошей работе дорожников они не успевают по производительности; во-вторых, в холодную погоду производительность падает. Поэтому мы стараемся своих клиентов ограничивать 160-тонной установкой. Стараемся объяснить, что это оптимальный вариант и по производительности, и по стоимости, и по качеству. Для увеличения производительности предприятия берут две установки и ставят на одной площадке.

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

 

Асфальтосмесительная установка КА-160 | Демонтаж/монтаж АБЗ, БСУ

НАШИ УСЛУГИ

Планирование территории

Монтаж/перебазировка/демонтаж/ремонт АБЗ, РБУ

Пуско – наладочные работы

Подготавливаем площадку для монтажа и установки АБЗ и РБУ.

Производим выравнивание, уплотнение грунта, монтаж опалубки и заливки фундамента, а также настил дорожных плит.

Производим работы по монтажу/демонтажу, диагностике, оценке и подбору, как новых, так и б/у АБЗ и БСУ. Капитальный ремонт всех узлов, настройка горелок, модернизация а/с, поставка запасных частей АБЗ. Тарировка весовых модулей заводов. Установка автовесов и настройка.

Установка программного обеспечения на ПК, шэф-монтажные работы, пуско-наладка АБЗ КА-160. Расключение электрики, подключение нагрузки, заземления и освещения АБЗ, БСУ. Настройка рецептов и выпуск асфальтобетонной смеси.

О НАС

Мы – команда профессионалов. Работаем более 15 лет по выпуску Асфальтобетонных смесей. Наша компания проводит сервисное обслуживание асфальтобетонных заводов.

Спектр наших услуг: монтаж/демонтаж/перебазировка АБЗ и БСУ, диагностика, консультирование, ремонт, модернизация старого оборудования, поставка запчастей, настройка рецептов, выпуск асфальта и бетона. Имея серьезный технический опыт, мы поддерживаем работу Вашего завода круглосуточно — 24/7. Наша первоочередная задача — решать все технические сложности, с которыми сталкивается Ваше предприятие.

Наши партнёры:

КАК НАС НАЙТИ

КОНТАКТЫ

433508, Ульяновская область, г. Димитровград ул. Гагарина, д. 9А, офис 1

www.abz63.ru     www.абз63.рф

[email protected]

ru

+7 (9277) 74-80-57

+7 (9279) 84-85-06

С удовольствием ответим на все ваши вопросы по телефонам:

 +7 (9277) 74-80-57, +7 (9279) 84-85-06

Для заказа коммерческого предложения по монтажу/демонтажу АБЗ, РБУ на электронную почту, воспользуйтесь формой обратной связи.

Контакты Завод барабан смесь асфальта

Производство грохота оптом на экспорт. ТОП 50

Jul 22,  · Выбрать грохот: узнать наличие, цены и купить онлайн. Крупнейшие экспортеры из России, Казахстана, Узбекистана, Белоруссии, официальные контакты

Learn More

Асфальтобетонные заводы купить – STTS Group

В отдельно стоящий бункер смесь загружается при помощи скиповой дороги. Бункер очень необходим, чтобы иметь запас готового асфальта и непрерывно производить и отгружать асфальт;

Learn More

Mobile Asphalt Plants | A

Барабан покры т слоем теплоизоляции толщиной 50 мм. Такое покрытие обеспечивает стабильную тем пературу внутри барабана, а также позволяет полностью высушить смесь.

Learn More

ALMCOR MACHINERY

Компания almcor machinery, дилер , осуществляет прямые, комплексные поставки техники и оборудования, с последующим гарантийным и сервисным обслуживанием по всей территории России.. . Страна-производитель: Швейцария.

Learn More

Как работает асфальтобетонный завод горячей смеси?

Завод горячей асфальтобетонной смеси в первую очередь нагревает заполнители, что

Learn More

сушильный барабан – асфальтный завод агрегаты Drying

Сушильный барабан является одной из самой центральной частью асфальтного завода.  Сушильный барабан является одним из основных компонетов АБЗ , он использует тепло,поступающее из горелки,для нагрева холодного агрегата

Learn More

Асфальтосмесительная установка «КА-160

Барабан сушильный Смесительное устройство; Бункер готового асфальта; Устройство очистки отходящих газов 2004- Колокшанский Агрегатный Завод

Learn More

Применение дозаторов и бункерных весов

Применение дозаторов и бункерных весов По мере своей эволюции, весы, при помощи светлых умов их создателей, проделали огромный путь от рычажных механических до современных электронных, которые при помощи

Learn More

Асфальт и асфальтобетон с доставкой – цена за тонну 2340

Асфальтобетон – это смесь материалов, щебёнки или песка с битумом, взятых в нужном соотношении и замешанных в горячем состоянии. Производство и укладка асфальта

Learn More

Асфальтобетонный мобильный завод QLB30

мини-завод, мобильный асфальтный завод, линия по производству асфальта qlb 30, передвижная линия по производству асфальта qlb 30, qlb 30 Купить, qlb 30 отзывы, qlb 30 цена, мобильный асфальтный завод qlb 30

Learn More

Zhengzhou Unique Industrial Equipment Co., Ltd. – Concrete

Zhengzhou Unique Industrial Equipment Co., Ltd., Experts in Manufacturing and Exporting Concrete Mixing Plant/ Asphalt Plant/ Mobile Batch Plant/ Concrete Mixer and 7394 more Products.

Learn More

ЛОЗАРТАН КАНОН 0,1 N30 ТАБЛ П/ПЛЕН/ОБОЛОЧ

Классификация ВОЗ частоты развития побочных эффектов:

очень часто – >1/10 назначений (>10%)

часто – от >1/100 до < 1/10 назначений (>1% и <10%)

нечасто – от >1/1000 до <1/100 назначений (>0.1 % и < 1 %)

редко – от >1/10000 до <1/1000 назначений (>0. 01% и <0.1%)

очень редко – <1/10000 назначений (<0.01 %)

частота неизвестна – по имеющимся данным установить частоту возникновения не представляется возможным.

Нарушения со стороны системы крови и лимфатической системы

Часто: анемия.

Редко: тромбоцитопения

Нарушения со стороны иммунной системы

Редко: кожная сыпь, крапивница, зуд, ангионевротический отек (включая отек гортани и языка), отек Квинке, аллергический васкулит, пурпура Шенляйна-Геноха.

Нарушения психики

Нечасто: беспокойство.

Частота неизвестна: депрессия.

Нарушения со стороны нервной системы

Часто: головокружение, головная боль, астения, повышенная утомляемость, нарушение сна, бессонница.

Нечасто: сонливость, расстройство памяти, периферическая нейропатия, парестезии, гипестезии, мигрень, тремор, атаксия, синкопе, острое нарушение мозгового кровообращения.

Частота неизвестна: нарушение вкуса.

Нарушения со стороны органа зрения

Нечасто: нарушение остроты зрения, конъюнктивит.

Нарушения со стороны органа слуха и лабиринтные нарушения

Нечасто: звон в ушах.

Нарушения со стороны органа вкуса

Нечасто: нарушение вкуса.

Нарушения со стороны сердца

Часто: ощущение сердцебиения, тахикардия, брадикардия, аритмия. Нечасто: стенокардия.

Редко: фибрилляция предсердий.

Нарушения со стороны сосудов

Нечасто: ортостатическая гипотензия (дозозависимая).

Редко: васкулит.

Нарушения со стороны дыхательной системы, органов грудной клетки и средостения

Часто: кашель, инфекции верхних отделов дыхательных путей (повышенная температура тела, боль в горле, фарингит, ринит, синусит, бронхит), заложенность носа.

Нечасто: одышка, ринит.

Нарушения со стороны желудочно-кишечного тракта

Часто: тошнота, диарея, боль в животе, диспепсические расстройства. Нечасто: анорексия, сухость во рту, рвота, метеоризм, запор, гастрит. Частота неизвестна: панкреатит

Нарушения со стороны печени и желчевыводящих путей Нечасто: нарушение функции печени.

Редко: гепатит.

Нарушения со стороны кожи и подкожных тканей

Нечасто: сухость кожи, эритема, гиперемия кожи, повышенное потоотделение, алопеция.

Частота неизвестна: фотосенсибилизация.

Нарушения со стороны скелетно-мышечной и соединительной ткани Часто: судороги, миалгии, боль в спине, грудной клетке, ногах.

Нечасто: артрит, артралгии, боль в плече, колене, фибромиалгия, рабдомиолиз.

Нарушения со стороны почек и мочевыводящих путей

Часто: нарушение функции почек

Нечасто: инфекции мочевыводящих путей, императивные позывы на мочеиспускание, острая почечная недостаточность.

Нарушения со стороны половых органов и молочной железы Нечасто: снижение либидо, эректильная дисфункция / импотенция.

Общие нарушения

Часто: астения, повышенная утомляемость.

Лабораторные и инструментальные данные

Часто: гиперкалиемия, умеренное повышение уровня мочевины и креатинина в сыворотке крови

Нечасто: гипогликемия, гипонатриемия, гиперурикемия.

Очень редко: повышение активности «печеночных» ферментов, гипербилирубинемия.

синтетический подход раскрывает широкие возможности настройки передачи сигналов ауксина | Физиология растений

Аннотация

Объяснение того, как низкомолекулярный ауксин вызывает разнообразные, но специфические реакции, является давней проблемой в биологии растений. Важным этапом реакции на ауксин является деградация белков-репрессоров ауксина/индол-3-уксусной кислоты (Aux/IAA, именуемая далее как IAA) посредством взаимодействия с ауксиновыми рецепторами. Чтобы систематически охарактеризовать разнообразие поведения деградации среди пар IAA | рецептор, мы сконструировали ауксин-индуцированную деградацию растительных белков IAA в дрожжах ( Saccharomyces cerevisiae ).Мы обнаружили, что динамика деградации IAA широко варьируется в зависимости от того, какой рецептор присутствует, и не кодируется исключительно доменом II, содержащим degron. Чтобы облегчить это и будущие исследования, мы определили математическую модель, способную количественно описать поведение деградации IAA в одном параметре. Вместе наши результаты демонстрируют замечательную настраиваемость, обеспечиваемую специфическими конфигурациями пути ответа ауксина.

Ауксин управляет почти всеми аспектами биологии растений, однако то, как специфичность создается сигнальными компонентами ауксина, остается в значительной степени нерешенным.Ряд связанных с ауксином фенотипов, в том числе глубокие нарушения в развитии и сильно нарушенные реакции на сигналы окружающей среды, вызваны заменами одной аминокислоты, которые стабилизируют корепрессорные белки транскрипции, называемые ауксин/индол-3-уксусными кислотами (Aux/IAA, обозначаемые как далее как IAA; Chapman and Estelle, 2009). Разнообразие этих фенотипов и размер семейства IAA предполагают, что IAA могут обеспечивать специфичность ауксиновых ответов (Lokerse and Weijers, 2009).Функциональные исследования подтверждают эту идею, поскольку стабилизированные IAA вызывают разные фенотипы даже при экспрессии с одного и того же промотора (Weijers et al., 2005; Muto et al., 2007).

Ауксин активирует экспрессию генов, усиливая оборот IAA посредством взаимодействия с ауксиновыми рецепторами, семейством белков F-box, называемых TRANSPORT INHIBITOR RESISTANT1 (TIR1)/AUXIN SIGNALING F-BOX PROTEINS (AFBs; Dharmasiri et al., 2005a; Kepinski and Leyser). , 2005), в совокупности именуемые здесь AFB. Недавно было обнаружено изменение сродства пар IAA|AFB (Calderón Villalobos et al., 2012). Как такие различия связаны с кинетикой деградации, до сих пор неясно. Трудоемкие исследования проростков небольшого количества белков IAA в сочетании с анализом стабилизированных мутантов IAA выявили важность консервативной области, называемой доменом II, в определении стабильности белка. Дегрон-содержащий домен IAA II одновременно необходим и достаточен для взаимодействия с TIR1 и результирующей ауксин-индуцированной деградации (Ramos et al., 2001; Dharmasiri et al., 2005a; Kepinski and Leyser, 2005; Tan et al., 2007). Кроме того, слияния IAA-репортер с различными последовательностями домена II демонстрируют диапазон скоростей деградации при сверхэкспрессии в проростках Arabidopsis ( Arabidopsis thaliana ) (Dreher et al., 2006). Однако повсеместное распространение ауксина в растениях и сложность восстановления полного механизма деградации in vitro препятствуют дальнейшей характеристике молекулярных детерминант скорости деградации ИУК.

В дополнение к существующим системам и для систематической характеристики потенциальной настраиваемости различных пар IAA|AFB мы разработали ауксин-индуцированную деградацию белков IAA в дрожжах Saccharomyces cerevisiae .Наша синтетическая система имеет несколько преимуществ: точный контроль уровней входа ауксина, возможность изучать пары IAA|AFB изолированно и отсутствие многих других путей, влияющих на передачу сигналов ауксина у растений (Stewart and Nemhauser, 2010). Наша система позволила провести всестороннее исследование оборота белка IAA, повторяя поведение, наблюдаемое у растений. Мы обнаружили, что конкретный используемый рецептор AFB сильно влиял на скорость деградации и что последовательности за пределами degron-содержащего домена II ускоряли или замедляли деградацию IAA специфичным для IAA образом.Более того, мы определили математическую модель, которая предоставляет единственный параметр для количественного описания поведения при деградации. Синтетический инструментарий, описанный здесь, облегчит быструю проверку гипотез об убиквитинировании белков IAA и предлагает средства для характеристики других путей деградации белков, индуцированных гормонами.

РЕЗУЛЬТАТЫ

Система синтетических дрожжей повторяет динамику деградации IAA, индуцированную ауксином

Наша сконструированная система ответа на ауксин состояла из парных скрещиваний дрожжей, экспрессирующих либо слитые белки желтого флуоресцентного белка (YFP)-IAA, либо AFB (рис. 1А). В присутствии функциональной КУМ флуоресценция YFP (прокси для уровней белка IAA) может регулироваться как вверх, так и вниз путем модулирования уровней индол-3-уксусной кислоты, далее именуемой ауксином (рис. 1B; Дополнение). Рис. S1). Сроки и степень деградации были сопоставимы с экспериментальными системами, основанными на гораздо более высокой концентрации синтетического ауксина (Nishimura et al., 2009). Проточная цитометрия предоставила профили деградации IAA с высоким разрешением для каждой пары IAA|AFB с улучшенными измерениями временного разрешения на уровне одной клетки (рис.1С). В отличие от скорости «базовой деградации», наблюдаемой у растений (Dreher et al., 2006), белки YFP-IAA были практически стабильными в дрожжах в отсутствие ауксина или функционального AFB (дополнительные рисунки S2 и S3). Это может отражать сложность полного удаления ауксина из растительных клеток или наличие в растениях дополнительных компонентов, отсутствующих в нашей синтетической системе. После основных событий деградации, вызванных ауксином, можно наблюдать более постепенное снижение YFP. Поскольку такое поведение также наблюдалось у штаммов, экспрессирующих mTIR1, мы полагаем, что это снижение флуоресценции вызвано физиологическими изменениями, связанными с увеличением плотности культуры, а не индуцированной ауксином деградацией YFP-IAA.

Рисунок 1.

Деградация IAA сильно варьируется. A, растительные ауксиновые рецепторы (TIR1 или AFB2) и репрессоры IAA, меченные YFP, были интегрированы в путь убиквитина дрожжей, показанные серым цветом. B, дрожжевые клетки были визуализированы при воздействии прямоугольной волны ауксина. Ауксин приводит к быстрому снижению YFP (флюоресценция отдельных микроколоний синего цвета, среднее значение черного цвета), которое может быть восстановлено удалением ауксина. C. Диапазон скоростей деградации IAA|рецептора был получен с использованием проточной цитометрии с интервальной съемкой.Кривые деградации нормализовали к начальной флуоресценции. IAA перечислены в порядке относительной разницы в деградации в присутствии TIR1 по сравнению с AFB2. Штаммы, экспрессирующие mTIR1 с дефицитом F-box, не обнаруживают ауксин-зависимой деградации. [См. онлайн-статью для цветной версии этого рисунка.]

Рисунок 1.

Деградация IAA сильно варьируется. A, растительные ауксиновые рецепторы (TIR1 или AFB2) и репрессоры IAA, меченные YFP, были интегрированы в путь убиквитина дрожжей, показанные серым цветом.B, дрожжевые клетки были визуализированы при воздействии прямоугольной волны ауксина. Ауксин приводит к быстрому снижению YFP (флюоресценция отдельных микроколоний синего цвета, среднее значение черного цвета), которое может быть восстановлено удалением ауксина. C. Диапазон скоростей деградации IAA|рецептора был получен с использованием проточной цитометрии с интервальной съемкой. Кривые деградации нормализовали к начальной флуоресценции. IAA перечислены в порядке относительной разницы в деградации в присутствии TIR1 по сравнению с AFB2. Штаммы, экспрессирующие mTIR1 с дефицитом F-box, не обнаруживают ауксин-зависимой деградации. [См. онлайн-статью для цветной версии этого рисунка.]

Высокое временное разрешение наших измерений привело к сложным профилям деградации, которые включали начальную задержку деградации перед экспоненциальным спадом уровней YFP (рис. 1, B и C; Дополнительный рис. S9). Таким образом, стандартные расчеты периода полураспада были недостаточны для описания динамики деградации в нашей системе. Чтобы количественно охарактеризовать поведение деградации каждой пары IAA|AFB, мы идентифицировали нелинейную модель второго порядка, которая фиксирует динамическую реакцию ауксина как во времени, так и в экспериментальных данных доза-реакция (рис.2А; Дополнительный файл S1; Дополнительные рис. С9–С11; Дополнительные таблицы S3 и S7). Эта модель объясняет сложное поведение деградации, которое мы наблюдали, и нелинейную связь между концентрацией ауксина и стационарной интенсивностью YFP (дополнительная рис. S1). Среди протестированных моделей-кандидатов эта модель имела наименьшую сложность, но при этом соответствовала данным с низкой остаточной ошибкой (дополнительный файл S1). Ответ ауксина представлен выходной интенсивностью флуоресценции YFP-IAA х и гипотетическим внутренним состоянием х , в зависимости от входной концентрации ауксина х .Гипотетическое внутреннее состояние x не измеряется напрямую в наших экспериментах и ​​не обязательно приравнивается к конкретным активным частицам, хотя одна интерпретация состоит в том, что x представляет собой комплекс, образованный между ауксином и AFB. Аналогичным образом, параметры K 1 , K , K 2 , K 3 , K 4 и K 5 не предназначены для прямых ассоциаций с физическими значениями в система.Одна из возможностей заключается в том, что эти скорости коррелируют с синтезом ( к 1 для внутреннего состояния и к 3 для IAA), деградацией внутреннего состояния ( к 2 ), базальной деградацией/разбавлением IAA ( k 4 ) и деградации, вызванной КУМ ( k 5 ). С помощью этой интерпретации и применения принципов подбора глобальной кривой мы уменьшили общее количество параметров, необходимых для соответствия всему набору данных (дополнительный файл S1).

Рисунок 2.

Динамику деградации можно описать с помощью нескольких параметров. А. Наша модель описывается двумя обыкновенными дифференциальными уравнениями. Показаны кривые деградации для штаммов AFB2, экспрессирующих IAA1 или дрожжевой кодон-оптимизированный IAA1.1. B, k   5 в значительной степени не зависит от уровня экспрессии. Кривые деградации IAA1 и IAA1.1 перекрываются после нормализации, хотя имеется примерно двукратная разница в значениях k   3 .C, пары IAA|AFB2 имеют повышенную скорость деградации ( k 5 ), другой порядок ранжирования по сравнению с парами IAA/TIR1 и увеличенный динамический диапазон между самой медленной и самой быстрой парами. Параметры оценивали для двух независимых повторностей. Все планки погрешностей представляют 1 стандартное отклонение. Дополнительные параметры перечислены в дополнительных таблицах S4 и S5. а.е., произвольные единицы. [См. онлайн-статью для цветной версии этого рисунка.]

Рисунок 2.

Динамику деградации можно описать с помощью нескольких параметров.А. Наша модель описывается двумя обыкновенными дифференциальными уравнениями. Показаны кривые деградации для штаммов AFB2, экспрессирующих IAA1 или дрожжевой кодон-оптимизированный IAA1.1. B, k   5 в значительной степени не зависит от уровня экспрессии. Кривые деградации IAA1 и IAA1.1 перекрываются после нормализации, хотя имеется примерно двукратная разница в значениях k   3 . C, пары IAA|AFB2 имеют повышенную скорость деградации ( k 5 ), другой порядок ранжирования по сравнению с парами IAA/TIR1 и увеличенный динамический диапазон между самой медленной и самой быстрой парами.Параметры оценивали для двух независимых повторностей. Все планки погрешностей представляют 1 стандартное отклонение. Дополнительные параметры перечислены в дополнительных таблицах S4 и S5. а.е., произвольные единицы. [Цветную версию этого рисунка см. в онлайн-статье.]

В результате моделирования различия, наблюдаемые в деградации между парами IAA|AFB, были объединены в один параметр, k   5 . Важно отметить, что значение k   5 для каждой пары IAA|AFB согласуется с качественным поведением, присутствующим в экспериментальных данных (рис.1С и 2С). Например, IAA с более быстрой деградацией имели самые большие значения k   5 , в то время как более стабильные IAA имели самые низкие значения k   5 . Из всех параметров k   5 лучше всего отражает характер деградации IAA|AFB и далее называется скоростью деградации.

Белки IAA демонстрируют различные скорости деградации

В нашей системе деградация, вызванная ауксином, различается для пар IAA|AFB (рис. 1С и 2С). Это согласуется с предыдущей работой на проростках арабидопсиса, где периоды полураспада сверхэкспрессированных гибридов IAA-LUC рассчитывали путем блокирования образования нового белка циклогексимидом и экзогенной обработки синтетическим ауксином 2,4-дихлорфеноксиуксусной кислотой (Dreher et al., 2006; Дополнительная таблица S1). В этих анализах сильное совпадение с последовательностью консенсусного домена II коррелировало с коротким периодом полужизни белка в присутствии 2,4-дихлорфеноксиуксусной кислоты. Например, IAA17 и IAA28 имеют сильное совпадение с консенсусным доменом II и периодом полураспада 5 и 15 минут соответственно.Напротив, IAA31 с расходящимся доменом II имеет период полувыведения примерно 4 часа. IAA20 не имеет узнаваемой последовательности домена II и обладает высокой стабильностью. Мы наблюдали аналогичные закономерности деградации у дрожжей (рис. 1C и 2C). В дрожжах, экспрессирующих либо TIR1, либо AFB2, IAA с согласованной последовательностью домена II быстро деградировали, IAA31 деградировала медленно, а IAA20 не демонстрировала деградации. Из IAA с последовательностями консенсусного домена II большинство пар IAA|TIR1 имели скорость, подобную скорости быстрого разложения IAA17|TIR1 (рис.2С). Мы наблюдали несколько ИУК вне этой общей тенденции, включая медленно разлагающуюся ИУК11.

Несмотря на то, что они экспрессируются с одного и того же промотора и по отдельности интегрированы в одно и то же место генома, IAA демонстрируют разные базовые уровни флуоресценции в дрожжах (дополнительная рис. S3). Наша модель предсказывает, что скорость экспрессии и деградации IAA не зависит друг от друга (дополнительный файл S1). Чтобы проверить это предсказание, мы синтезировали вариантный аллель IAA1 (IAA1.1) с кодонами, оптимизированными для дрожжей.Базальная экспрессия IAA1.1 была в два раза выше, чем у IAA1 (рис. 2А), с аналогичным кратным изменением расчетных значений k   3 (рис. 2B). Напротив, нормализованные кривые деградации и значения k 5 перекрываются (рис. 2, B и C). Этот результат подтверждает нашу модель и демонстрирует, что скорость деградации IAA действительно устойчива к колебаниям уровня экспрессии IAA. Проблемы в анализах растений, включая случайное расположение вставок и несколько типов клеток, способствующих вариациям в экспрессии трансгена, делают этот тип количественного анализа довольно сложным и подчеркивают преимущества использования дрожжей в качестве дополнительного ресурса для динамического анализа ответов ауксинов.

Скорость разложения IAA зависит от рецептора

Для большинства протестированных IAA AFB2 способствовал более быстрому разложению, чем TIR1 (рис. 1C и 2C). Это привело к тому, что пары IAA|AFB2 имели скорость деградации в три раза выше, чем пары IAA|TIR1. Пары IAA|AFB2 также имели более широкий диапазон скоростей деградации среди всех IAA. За исключением IAA с расходящимся доменом II, самая быстрая пара IAA|TIR1 (IAA8) имела скорость деградации в 3,3 раза выше, чем самая медленная, IAA11.Напротив, самая быстрая пара IAA|AFB2 (IAA17) имела скорость деградации в 5,5 раз выше, чем IAA11. Поразительно, но порядок скоростей деградации не сохранялся между штаммами, экспрессирующими разные рецепторы. IAA6 показал одну из самых медленных скоростей деградации с TIR1, однако он имел одну из самых быстрых скоростей деградации для пар IAA|AFB2. Подгруппа IAA показала небольшую разницу в деградации между рецепторами ауксина, что привело к некоторым из самых широких расхождений в относительном порядке ранжирования. Например, при переключении рецептора с TIR1 на AFB2 деградация IAA1 практически не менялась.Это привело к тому, что IAA1 стала одной из наиболее быстро разлагающихся IAA в сочетании с TIR1, но одной из самых медленных при экспрессии с AFB2. Хотя возможно, что AFB2 функционирует более эффективно, чем TIR1 в дрожжах, идентификация подмножества IAA, которые не обнаруживают изменений в деградации между двумя рецепторами, предполагает, что эти два белка по своей сути различаются по их взаимодействиям IAA.

В то время как TIR1 и AFB2 вызывали быструю ауксин-индуцированную деградацию IAA, AFB1 и AFB3 мало влияли на скорость деградации IAA (дополнительная рис.С4). Генетический анализ предполагает, что TIR1 и AFB2 являются основными ауксиновыми рецепторами у Arabidopsis, но до сих пор неясно, в какой степени каждый белок TIR1/AFB способствует специфическим ауксиновым ответам (Dharmasiri et al. , 2005b; Parry et al., 2009). Мутации в TIR1 или AFB2 приводят к более сильным общим фенотипам, связанным с ауксином, чем мутации в AFB1 или AFB3 , хотя потеря AFB1 или AFB3 может усилить мутации других членов семейства AFB3 . др., 2005б; Парри и др., 2009). Мы пришли к выводу, что КУМ могут различаться по своей способности взаимодействовать с ИУК. Эта гипотеза согласуется с нашими выводами, а также с исследованиями in vitro pull-down, показывающими, что AFB1 и AFB3 имеют более низкие уровни взаимодействия с IAA, чем TIR1 и AFB2 (Parry et al., 2009). Кроме того, слияния IAA-репортер сильно стабилизированы у мутантов afb2 , в то время как потеря AFB1 или AFB3 мало влияет на скорость оборота (Dharmasiri et al., 2005б). Дополнительным фактором может быть то, что наш анализ гетерологичной деградации менее чувствителен, чем другие анализы, к слабым или временным взаимодействиям IAA-AFB. Действительно, анализы in vitro pull-down и двухгибридные скрининги дрожжей показали низкие уровни взаимодействия между некоторыми парами IAA|AFB даже в отсутствие ауксина (Dharmasiri et al. , 2005a, 2005b; Kepinski and Leyser, 2005; Parry et al. al., 2009; Calderón Villalobos et al., 2012), в то время как мы не наблюдали каких-либо изменений в стабильности IAA без добавления ауксина (Supplemental Figs.С2 и С3). Более того, ауксин может усиливать взаимодействия между слитыми белками AFB1-ДНК-связывающего домена и слитыми белками домена активации IAA, когда обе конструкции сильно экспрессируются в дрожжах (Calderón Villalobos et al., 2012), что позволяет предположить, что эти более слабые взаимодействия могут способствовать ответу ауксина. в растениях. Потребуется дополнительная работа на заводах, чтобы различать эти различные возможности.

Уровни экспрессии рецепторов не влияли на деградацию ИУК в наших анализах на дрожжах.Скорость деградации не коррелировала с количеством рецепторов (дополнительная рис. S5) и не могла быть увеличена за счет добавления в геном второй копии того же рецептора (дополнительная рис. S6). Кроме того, когда коэкспрессировались TIR1 и AFB2, скорость деградации IAA6 почти соответствовала скорости деградации только AFB2 (дополнительная рис. S6). Генетические исследования показывают, что TIR1 является первичным рецептором ауксина, а AFB2 не способен замещать TIR1 даже при экспрессии с промотора TIR1 (Parry et al., 2009). Это говорит о том, что различия в скорости деградации не являются единственной отличительной характеристикой рецепторов и что дальнейшие функциональные исследования динамики деградации ИУК на фоне мутантных рецепторов могут быть плодотворными.

Остатки за пределами домена II по-разному влияют на скорость разложения

Было обнаружено, что остатки за пределами домена II вносят вклад в аффинность связывания ауксинов IAA|AFB in vitro (Calderón Villalobos et al., 2012) и высокие базовые скорости деградации IAA в проростках (Dreher et al., 2006). Мы разработали усечения в IAA с разной скоростью деградации (рис. 3A; дополнительная рис. S7), чтобы напрямую проверить роль остатков, не являющихся доменом II, в деградации, вызванной ауксином. N-концевая половина белка (T1) или меньшая область, ограниченная доменом II (T2), была слита с сигналом ядерной локализации SV40 (NLS; дополнительная таблица S2). Скорость деградации укороченных белков сравнивали с полноразмерными конструкциями, слитыми с теми же NLS (рис. 3, Б и В). Мы обнаружили, что последовательности вне домена II могут ускорять или замедлять скорость деградации IAA-специфическим образом.Относительный порядок скоростей деградации ИУК полной длины не сохранялся в усечениях. IAA28.T2 была самой быстрой деградацией укороченных T2, однако IAA28 показал гораздо более медленную скорость деградации, чем IAA1 или IAA6. Более того, параллельные усечения в разных IAA не оказывали одинакового влияния на скорость деградации. IAA6.T1 был медленнее, чем полноразмерный IAA6, но IAA28.T1 был быстрее, чем полноразмерный IAA28.

Рисунок 3.

Остатки вне домена II вносят свой вклад в скорость деградации, вызванную ауксином.A, Схема усечения IAA. B и C. Динамика деградации полноразмерных белков не сохраняется при укорочении. B, скорость деградации укороченных клеток, выраженных с помощью TIR1 или AFB2, нормализованная к начальной флуоресценции для каждого штамма. C, параметры K 3 и K 5 были определены с использованием параметров K 1 , K 2 и K 4 из предыдущей модели установки. Дополнительные параметры перечислены в дополнительной таблице S6.

Рисунок 3.

Остатки вне домена II способствуют скорости деградации, вызванной ауксином. A, Схема усечения IAA. B и C. Динамика деградации полноразмерных белков не сохраняется при укорочении. B, скорость деградации укороченных клеток, выраженных с помощью TIR1 или AFB2, нормализованная к начальной флуоресценции для каждого штамма. C, параметры K 3 и K 5 были определены с использованием параметров K 1 , K 2 и K 4 из предыдущей модели установки.Дополнительные параметры перечислены в дополнительной таблице S6.

Недавно обнаруженный ауксиновый сенсор DII-VENUS подобен IAA28. T2, но имеет сдвиг 15 аминокислот в сторону N-конца IAA28 (Vernoux et al., 2011; Brunoud et al., 2012). Чтобы проверить, влияет ли это небольшое различие в последовательности на скорость деградации, мы встроили в нашу систему идентичное укорочение IAA28 (IAA28.T2V; рис. 3A; дополнительная таблица S2). IAA28.T2V разлагался гораздо медленнее, чем все другие протестированные конструкции (рис.3Б). Этот эффект противоположен тому, что мы наблюдали с IAA28.T1 и IAA28.T2, оба из которых имели повышенную скорость деградации по сравнению с полноразмерным белком. Заметно более низкая скорость деградации, которую мы наблюдали для IAA28.T2V, может объяснить, почему это был самый яркий протестированный репортер (Brunoud et al., 2012). Фактически, наш анализ предсказал, что IAA8 и IAA9, другие укорочения IAA, протестированные в этом исследовании, будут разлагаться быстрее, чем IAA28 (рис. 2; дополнительная таблица S1). Это согласуется с более тусклой флуоресценцией, наблюдаемой у репортеров DII, полученных с этими белками IAA (Brunoud et al. , 2012). Чтобы напрямую проверить, могут ли наши анализы дрожжей предсказать относительную скорость деградации в растениях, мы создали трансгенные проростки, экспрессирующие модифицированный репортер DII-VENUS, где мы заменили последовательность IAA28.T2V на последовательность IAA28.T2. В соответствии с более высокой скоростью оборота слитого белка IAA28.T2 в дрожжах мы наблюдали значительно более низкие уровни флуоресценции репортера IAA28.T2 в трансгенных растениях (дополнительная рис. S8).

ОБСУЖДЕНИЕ

Размер и разнообразие семейств белков IAA и AFB предполагает, что специфичность ауксинов может быть обусловлена ​​специфическими конфигурациями членов семейств IAA и AFB (Lokerse and Weijers, 2009).В этом исследовании мы представляем новый метод исследования диапазона разнообразия, закодированного этими большими семействами. Перенеся растительные белки в дрожжи, мы смогли напрямую протестировать вариабельность скорости деградации между конкретными парами IAA|AFB. Мы смогли воспроизвести деградацию, вызванную ауксином, и получить данные в реальном времени с высоким разрешением. Наша дрожжевая платформа смогла повторить поведение, ранее наблюдавшееся в исследованиях оборота ИУК, и позволило провести обширное исследование поведения при деградации ИУК.

Оценивая деградацию с каждым рецептором в отдельности, мы показали, что деградация ИУК сильно зависит от того, какой рецептор присутствует, и что эти рецепторные эффекты специфичны для ИУК (рис. 1С и 2С). Наши данные свидетельствуют о выборе рецептора для регуляции оборота IAA и показывают, что каждый член пары IAA | AFB играет роль в определении чувствительности к ауксину. Высокое сходство последовательностей между TIR1 и AFB2 в сочетании с их общими субстратами должно предоставить платформу для анализа того, как белки F-бокса влияют на скорость убиквитинирования, фактор, который, как известно, варьируется среди других белков F-бокса (Pierce et al., 2009). Отсутствие обнаруживаемой деградации IAA у дрожжей, экспрессирующих AFB1 или AFB3, несмотря на их способность связывать ауксин, может иметь важное значение для калибровки ответов на ауксин. Это означает, что разные комбинации рецепторов могут давать разные пороги ответа, каждый из которых может запускать специфический регулируемый ауксином процесс (Reinhardt et al., 2003; Del Bianco and Kepinski, 2011).

Удивительно, но скорость деградации ИУК не сильно коррелировала с несколькими недавно опубликованными константами диссоциации in vitro (Calderón Villalobos et al., 2012; Дополнительная таблица S1). Это отсутствие корреляции может быть просто результатом искусственной природы обеих систем: константы диссоциации являются мерой комплексообразования и определяются независимо от полного убиквитинового комплекса, а наша гетерологичная система имеет смесь дрожжевых и растительных компонентов (рис. 1А). Однако поддающаяся проверке альтернативная гипотеза состоит в том, что сила взаимодействия между TIR1 и IAA не является прямым отражением того, насколько быстро разрушается IAA. Недавно было показано, что консервативные последовательности вне домена взаимодействия влияют на скорость деградации ряда субстратов комплекса, стимулирующего анафазу (Williamson et al. , 2011). В то время как подобные последовательности не были идентифицированы в белках IAA, тот факт, что укорочения имеют такие разные скорости деградации, ясно показывает, что дополнительные остатки играют решающую роль в модулировании взаимодействия с убиквитиновым аппаратом (Fig. 3; Dreher et al., 2006). Идентификацию детерминант скорости деградации ИУК можно ускорить, объединив информацию, полученную в результате исследований на дрожжах, in vitro и на растениях.

Используя небольшую модель, управляемую данными, мы смогли количественно охарактеризовать сложное поведение деградации каждой пары IAA|AFB в ответ на ауксин (рис.2). Математическое моделирование позволило нам выделить вклад IAA и AFB в деградацию и тем самым продемонстрировать, как можно настроить восприятие ауксина. Мы выбрали маленькую эмпирическую модель, потому что большие механистические модели (Bridge et al., 2012) требуют большего количества параметров, чем можно было бы определить из низкоразмерных выходных данных, доступных в наших экспериментах. Тем не менее, маленькие модели могут быть весьма полезными. Например, новая петля отрицательной обратной связи была обнаружена при осмоадаптации дрожжей с использованием подхода с использованием малой модели (Mettetal et al., 2008). Точно так же наша простая модель показала, что для описания динамики деградации IAA необходимы неизвестные молекулярные взаимодействия, выходящие за рамки сложного сродства. Кроме того, небольшие модели, такие как наша, могут обеспечить простое описание входных-выходных свойств модуля и облегчить рациональный дизайн новых систем в синтетической биологии.

В этом исследовании мы продемонстрировали полезность переноса пути к ортогональному организму для характеристики его функции. Как одноклеточный эукариот с консервативным клеточным механизмом, дрожжи обеспечивают полуестественный контекст, облегчающий изучение сложных сигнальных путей.Быстрое время генерации, контроль места и количества вставки и высокопроизводительные методы количественного анализа в сочетании с отсутствием других известных искажающих факторов, таких как транспорт ауксина, метаболизм ауксина и коэкспрессия членов семейства AFB и IAA, делают исследования в дрожжи являются сильным дополнением к исследованиям растений. Учитывая очевидную искусственность нашей системы, весьма многообещающе, что ранг скорости деградации, вызванной ауксином, соответствует ограниченному количеству периодов полураспада, наблюдаемых у растений (дополнительная таблица S1).Тот факт, что конструкция IAA28.T2 вела себя, как и предполагалось, при экспрессии в проростках (рис. 3; дополнительная рис. S8), также указывает на общую консервативность детерминант деградации между растительными клетками и сконструированными дрожжами. Полный анализ сходств и различий между системами потребует дополнительных исследований растений и, вероятно, более совершенных инструментов для измерения динамического поведения растений. Наша гетерологичная система обеспечивает новый метод исследования передачи сигналов ауксина, а также предлагает средства для изучения многих других путей растений, которые зависят от убиквитин-опосредованной деградации белка.

МАТЕРИАЛЫ И МЕТОДЫ

Дрожжевые методы

Трансформацию дрожжей

проводили с использованием стандартного протокола ацетата лития (Gietz and Woods, 2002) в MAT a W303-1A или MATα W814-29B, подарок лаборатории Gottschling. Дрожжевую пептон-декстрозную (YPD) и синтетическую полную (SC) среду с добавлением 80 мг мл -1 аденина готовили в соответствии со стандартными протоколами. Все штаммы, использованные в этом исследовании, перечислены в дополнительной таблице S9.

Штаммовая конструкция

IAA, TIR1 и AFB были амплифицированы из комплементарной ДНК Arabidopsis ( Arabidopsis thaliana ) (экотип Колумбии) с использованием праймеров, перечисленных в дополнительной таблице S8. Частичный сайт attB1 и последовательность Козака (ААА) были добавлены к 5′-концу каждого прямого праймера (5′-AAAAAGCAGGCTTCAAA-3′), а частичный сайт attB2 был добавлен к 5′-концу каждого обратного праймера (5′- -АГАААГЦТГГГТГ-3′). Оставшиеся последовательности attB1 и attB2 были добавлены во время второй ПЦР с использованием общих прямых и обратных праймеров адаптера (5′-GGGGACAAGTTTGTACAAAAAAGCAGGCT-3′ и 5′-GGGGACCACTTTGTACAAGAAAGCTGGGT-3′).Продукты субклонировали в плазмиду Gateway pDONR221 с использованием стандартной реакции Gateway BP (BP Clonase II; Life Technologies). Каждую комплементарную ДНК полностью секвенировали, а затем клонировали в векторы назначения с помощью стандартной реакции Gateway LR (LR Clonase II; Life Technologies). ИУК клонировали в pGP4GY-ccdB (Trp-селекция), а ауксиновые рецепторы клонировали в pGP5G-ccdB (Leu-селекция; K.A. Havens, N. Bolten, J.L. Nemhauser и E. Klavins, неопубликованные данные). Приблизительно 300 нг каждой плазмиды расщепляли Pme I и трансформировали: pGP4GY-IAA в W303-1A, pGP5G-AFB в W814-29B.Интеграции подтверждали с помощью ПЦР. Штаммы для спаривания совместно инокулировали при низкой плотности в среду YPD, выращивали в течение ночи при 30°C и высевали в отдельные колонии на SC-His-Trp для отбора диплоидов.

укороченных фрагментов IAA сливали с N-концевым YFP и C-концевым повтором SV40 NLS с использованием линкеров Gly-Ala (GAGAGAGAGP и GAGA соответственно; Nishimura et al., 2009). Конструкцию IAA17.T1 синтезировали с частичным EYFP и полной последовательностью NLS (www.genewiz.com), а затем клонировали в основу вектора pGP4GY-ccdB с помощью сборки Гибсона (Gibson et al. , 2009). Схема клонирования представлена ​​на дополнительной фигуре S7. Праймеры перечислены в дополнительной таблице S8. Сайты-акцепторы шлюза были удалены этим процессом. Дальнейшие укороченные конструкции амплифицировали из полноразмерных последовательностей IAA и клонировали вместо IAA17 с использованием сборки Gibson (Gibson et al., 2009).

Плазмида DII-VENUS была подарком от Teva Vernoux. Плазмида IAA28.T2-VENUS была сконструирована путем замены области DII DII-VENUS областью degron IAA28.T2 с использованием сборки Gibson (Gibson et al., 2009).

Проточная цитометрия

Измерения интенсивности

YFP были выполнены с помощью проточного цитометра BD Accuri C6 с адаптером планшета CSampler с использованием длины волны возбуждения 488 и 640 нм и фильтра обнаружения эмиссии при 533 нм (канал FL1). Всего для каждого образца было измерено 10 000 событий выше порога 400 000 FSC-H (для исключения дебриса) при расходе 66 мкл мин -1 и размере ядра 22 мкм с использованием программного обеспечения Accuri C6 CFlow Sampler. Данные цитометрии были экспортированы как FCS 3.0 и обработаны с помощью программного пакета flowCore R и пользовательских сценариев R для получения среднего значения FL1-A в каждый момент времени. Сценарий применяет к данным два полигональных элемента, чтобы изолировать отдельные дрожжевые клетки. Одни ворота отделяют общую популяцию дрожжей от мусора в каналах SSC-A и FSC-A. Вторые ворота изолируют отдельные клетки от агрегатов клеток (дискриминация дублетов) за счет их более высокого отношения FSC-H (высота пика) к FSC-A (площадь пика). Скрипты доступны по запросу.

Анализы деградации

Клетки

готовили путем переноса свежевыращенной колонии из чашек YPD в SC.Плотность клеток (в мкл -1 ) оценивали с использованием данных цитометрии, отобранных для дрожжей с помощью пользовательского R-скрипта. Затем каждую культуру разбавляли до 0,5 событий мкл -1 в 15 мл SC. Это разведение было разделено на двойные аликвоты по 4 мл, за исключением контролей. Для IAA17 без метки YFP и YFP без IAA готовили только одну аликвоту объемом 4 мл. YFP-IAA17 был разделен на три аликвоты, чтобы служить внутренним контролем повторения в каждом эксперименте. Аликвоты инкубировали в течение 16 ч при 30°С при встряхивании.Через 16 часов повторные аликвоты каждого штамма смешивали и снова делили на две пробирки. Культуры находились в логарифмической фазе в начале каждого эксперимента (плотность измерялась в цитометре примерно при 500 событиях мкл -1 ) и оставались в логарифмической фазе на протяжении всего эксперимента (дополнительная рис. S2).

Измерения проводились в двух временных точках до добавления какого-либо лечения. Для каждого штамма один повтор обрабатывали имитацией (95% [об./об.] этанол), а один повтор обрабатывали 10 мкМ индол-3-уксусной кислоты (минимальная концентрация ауксина, необходимая для обеспечения полной деградации ИУК во время логарифмической фазы роста). дрожжей; дополнительные рис.С1 и С2). Как можно быстрее после добавления ауксина регистрировали флуоресценцию для 0-минутной точки времени. Последующие измерения проводились с 10-минутными интервалами в течение первых 2 часов после добавления ауксина и затем каждые 30 минут, пока уровень флуоресценции в большинстве штаммов не стабилизировался (примерно 3,5 часа). Контрольные образцы измеряли каждый час на протяжении всего эксперимента.

Моделирование и количественный анализ

Методы моделирования и количественный анализ описаны в дополнительном файле S1.

Микроскопия

Клетки дрожжей, выращенные в течение ночи в SC при 30°C, разводили 1:100 в SC, инкубировали в течение 4–5 часов, а затем разбавляли 1:20 перед загрузкой на планшет Y04D (CellASIC). Используя микрожидкостную систему CellASIC-ONIX и соответствующее программное обеспечение, клетки подвергали импульсной обработке прямоугольной волной ауксина 10 мкм в подкожной среде в течение 2 часов. Инвертированный микроскоп Nikon Eclipse Ti с масляным объективом 60× с числовой апертурой 1,4 использовали для изображения дрожжевых клеток с 5-минутными интервалами с использованием полосового фильтра YFP-HYQ 535 (Nikon; возбуждение при 515 нм, обнаружение от 520 до 550 нм). ) и 14-битная камера CoolSNAP HQ2.Обработка изображений выполнялась с помощью пользовательских сценариев MATLAB, которые можно получить по запросу. Вкратце, алгоритм сегментации был применен к изображениям в светлом поле для создания бинарной маски для каждой микроколонии. Затем эту бинарную маску применяли к изображению YFP для расчета среднего значения интенсивности YFP в колонии. Уровень фоновой флуоресценции оценивали по средней флуоресценции квадрата размером 100×100 пикселей, удаленного от колонии дрожжей, и вычитали из значений общей флуоресценции.

Получение и анализ трансгенных растений

растения экотипа Колумбия были трансформированы методом цветочного погружения (Clough and Bent, 1998).Растения T1 отбирали на чашках с агаром 0,5× LS, содержащих 30 мкг мл -1 гигромицина B. Чашки стратифицировали в течение 2 дней, выдерживали на свету в течение 6 часов, а затем выращивали в темноте в течение 3 дней после модификации метода. Харрисон и др. (2006). Устойчивые проростки переносили на чашки, не содержащие антибиотиков, и оставляли для восстановления еще на 3 дня. Семена DII-VENUS, щедро предоставленные Teva Vernoux, были выращены в идентичных условиях, чтобы можно было провести прямое сравнение IAA28.Конструкции T2 и IAA28.T2V в растениях.

Растения получали с помощью микроскопа Leica DMI 3000B, оснащенного долговременным объективом Leica 20× HCX PL FLUORTAR, и освещали источником света Lumencor SOLA. Изображения были получены с использованием программного обеспечения Leica LAS AF версии 2.6.0 и камеры Leica DFC 345FX. Семь независимых трансформантов IAA28.T2 исследовали и сравнивали с 10 проростками DII-VENUS. Программное обеспечение Fiji использовалось для количественной оценки флуоресценции в интересующей области, сосредоточенной на каждом изображении.

Дополнительные данные

В онлайн-версии этой статьи доступны следующие материалы.

БЛАГОДАРНОСТИ

Мы благодарим Марка Эстель, Нин Чжэн и членов групп Nemhauser и Klavins за полезные обсуждения, а также Алека Нильсона, Сельму Алкафиф и Брэнди Хаус за техническую помощь.

Глоссарий

  • IAA

    AUXIN / IAA

    AUXIN / INAO

    AUXIN / ENDOLE-3-уксусная кислота

  • YFP

    желтый флуоресцентный белок

  • NLS

    сигнал ядерной локализации

  • SC

    Синтетическая среда, дополненная 80 мг мл – 1 аденин

ЦИТИРОВАННАЯ ЛИТЕРАТУРА

(

2012

)

Выявление возможных механизмов ауксин-опосредованного контроля развития у арабидопсиса: модели с двумя белками Aux/IAA и ARF и двумя наборами генов-мишеней

.

Math Biosci

 

235

:

32

44

и другие. (

2012

)

Новый датчик для картирования реакции и распределения ауксина с высоким пространственно-временным разрешением

.

Природа

 

482

:

103

106

и другие. (

2012

)

Комбинаторная корецепторная система TIR1/AFB-Aux/IAA для дифференциального восприятия ауксина

.

Nat Chem Biol

 

8

:

477

485

(

2009

)

Механизм регулируемой ауксином экспрессии генов в растениях

.

Annu Rev Genet

 

43

:

265

285

(

1998

)

Цветочное погружение: упрощенный метод опосредованной Agrobacterium трансформации Arabidopsis thaliana

.

Завод J

 

16

:

735

743

(

2011

)

Контекст, специфичность и самоорганизация ауксинового ответа

.

Колд Спринг Харб Перспект Биол

 

3

:

a001578

(

2005

)

Белок F-box TIR1 является рецептором ауксина

.

Природа

 

435

:

441

445

(

2005

)

Развитие растений регулируется семейством белков F – бокса ауксиновых рецепторов

.

Dev Cell

 

9

:

109

119

(

2006

)

Семейство белков Arabidopsis Aux/IAA отличается разнообразием в отношении деградации и чувствительности к ауксину

.

Растительная клетка

 

18

:

699

714

(

2009

)

Ферментативная сборка молекул ДНК длиной до нескольких сотен тысяч пар оснований

.

Nat Methods

 

6

:

343

345

(

2002

)

Трансформация дрожжей методом ацетата лития/одноцепочечной ДНК-носителя/полиэтиленгликоля

.

Методы Enzymol

 

350

:

87

96

(

2006

)

Быстрый и надежный метод идентификации трансформированных сеянцев Arabidopsis thaliana после трансформации цветочным погружением

.

Растительные методы

 

2

:

19

(

2005

)

Белок F-box TIR1 арабидопсиса представляет собой рецептор ауксина

.

Природа

 

435

:

446

451

(

2009

)

Ауксин входит в матрицу: сборка механизмов реагирования для конкретных результатов

.

Curr Opin Plant Biol

 

12

:

520

526

(

2008

)

Частотная зависимость осмоадаптации у Saccharomyces cerevisiae

.

Наука

 

319

:

482

484

(

2007

)

Специфичность и сходство функций генов Aux/IAA в передаче сигналов ауксина арабидопсиса, выявленные в экспериментах по обмену промоторов среди MSG2/IAA19 , AXR2/IAA7 1006

6

и AXR2/IAA7

.

Завод Физиол

 

144

:

187

196

(

2009

)

Дегроновая система на основе ауксина для быстрого истощения белков в нерастительных клетках

.

Nat Methods

 

6

:

917

922

(

2009

)

Комплексная регуляция семейства ауксиновых рецепторов TIR1/AFB

.

Proc Natl Acad Sci USA

 

106

:

22540

22545

(

2009

)

Обнаружение последовательного полиубиквитилирования в миллисекундном масштабе

.

Природа

 

462

:

615

619

(

2001

)

Быстрая деградация белков ауксина / индолуксусной кислоты требует консервативных аминокислот домена II и зависит от протеасом

.

Растительная клетка

 

13

:

2349

2360

(

2003

)

Регуляция филлотаксиса полярным транспортом ауксина

.

Природа

 

426

:

255

260

(

2010

)

Растут ли деревья на деньгах? Ауксин как валюта сотовой экономики

.

Колд Спринг Харб Перспект Биол

 

2

:

a001420

(

2007

)

Механизм восприятия ауксина убиквитинлигазой TIR1

.

Природа

 

446

:

640

645

и другие.(

2011

)

Сеть передачи сигналов ауксина преобразует динамический ввод в надежное формирование паттерна на верхушке побега

.

Мол Сист Биол

 

7

:

508

(

2005

)

Специфичность развития ответа на ауксин парами регуляторов транскрипции ARF и Aux/IAA

.

EMBO J

 

24

:

1874

1885

(

2011

)

Регуляция инициации цепи убиквитина для контроля времени деградации субстрата

.

Ячейка Mol

 

42

:

744

757

Примечания автора

© Американское общество биологов растений, 2012 г. Все права защищены.

© Автор(ы), 2012 г. Опубликовано Oxford University Press от имени Американского общества биологов растений. Это статья в открытом доступе, распространяемая в соответствии с условиями лицензии Creative Commons Attribution (https://creativecommons.org/licenses/by/4.0/), которая разрешает неограниченное повторное использование, распространение и воспроизведение на любом носителе при условии, что оригинальная работа правильно цитируется.

База данных неаннотированных секретируемых пептидов Arabidopsis, ресурс для пептидомики растений

Plant Physiol. 2006 ноябрь; 142(3): 831–838.

Отделение биологических наук Университета Миссури, Колумбия, Миссури 65211

Поступила в редакцию 11 июля 2006 г.; Принято 14 сентября 2006 г.

Copyright © Американское общество биологов растений, 2006 г. Эта статья цитируется в других статьях PMC.
Дополнительные материалы

[Дополнительные данные]

GUID: 0744C6C1-2E8A-4142-A23C-509D127BEB64

GUID: 25A3ADE8-0900-4999-88E7-15E16A9C8EAF

GUID: FC82281C-DCCA-4482-822C-DE4663604FD8

GUID: 717EFAD0-4FC7-42B2-B49C-86B4247BFBC8

Abstract

В эпоху геномики, если ген не аннотирован, он не исследуется. Из-за небольшого размера гены, кодирующие пептиды, часто не учитываются в аннотациях генома. Секретируемые пептиды являются важными регуляторами роста, развития и физиологии растений. Идентификация дополнительных пептидных сигналов путем поиска гомологии последовательностей имела ограниченный успех из-за гетерогенности последовательностей. Для поиска неаннотированных пептидов Arabidopsis ( Arabidopsis thaliana ) был применен биоинформатический подход. В хромосомных последовательностях арабидопсиса был проведен поиск всех открытых рамок считывания (ORF), кодирующих пептиды и небольшие белки длиной от 25 до 250 аминокислот.Транслированные ORF затем последовательно опрашивали на наличие амино-концевого отщепляемого сигнального пептида, отсутствие трансмембранных доменов и отсутствие последовательностей удерживания просвета эндоплазматического ретикулума. Затем ORF были отфильтрованы по аннотированным генам арабидопсиса The Arabidopsis Information Resource 6.0, чтобы удалить те ORF, которые перекрывают известные гены. Остальные 33 809 ORF были помещены в реляционную базу данных, в которую были внесены дополнительные данные аннотаций. Данные массива тайлов всего генома сравнивали с координатами ORF, подтверждая возможность того, что многие из ORF могут быть экспрессированы.Кроме того, кластеризация и анализ сходства последовательностей показали, что многие из предполагаемых пептидов находятся в семействах генов и/или, по-видимому, присутствуют в геноме риса ( Oryza sativa ). Подмножество ORF оценивали с помощью обратной транскрипции-ПЦР, и для одной пятой из них была обнаружена экспрессия. Эти результаты подтверждают идею о том, что количество и разнообразие растительных пептидов шире, чем предполагается в настоящее время. Идентифицированные пептиды и данные их аннотаций можно просматривать или загружать через веб-интерфейс с возможностью поиска на сайте peptidome.Миссури.edu.

Пептидные сигналы контролируют различные аспекты физиологии, роста и развития растений. Например, продемонстрирована роль пептидных сигналов в защитных реакциях (McGurl et al. , 1992; Huffaker et al., 2006), поддержании идентичности стволовых клеток в апикальной меристеме побега (Fletcher et al., 1999; Kondo et al. ., 2006), самонесовместимость у видов крестоцветных (Schopfer et al., 1999; Takayama et al., 2000) и пролиферация и дифференцировка клеток (Matsubayashi and Sakagami, 1996; Matsubayashi et al., 1999; Ито и др., 2006). Эти сигнальные пептиды действуют через рецепторы клеточной поверхности, вызывая физиологические реакции. Кроме того, существуют пептиды, которые действуют как прямые эффекторы, такие как антимикробные пептиды, участвующие во врожденном иммунитете, или фитохелатины, ограничивающие абиотический стресс, вызванный токсичными металлами (Garcia-Olmedo et al., 1998; Cobbett and Goldsbrough, 2002).

Выяснение роли дополнительных растительных пептидов необходимо для понимания межклеточной коммуникации, лежащей в основе биологии растений.Узким местом в процессе установления функций растительных пептидов была идентификация генов, кодирующих пептиды. Это связано с тем, что многие пептиды кодируются небольшими генами, которые, как правило, не учитываются в аннотациях генома.

Одно свидетельство того, что малые гены, кодирующие пептиды, недостаточно аннотированы у Arabidopsis ( Arabidopsis thaliana ), включает несколько примеров больших семейств генов растительных пептидов, пропущенных в аннотации генома. В таких случаях идентификация пептида-основателя позволяла распознавать дополнительных неаннотированных членов семейства с помощью поиска гомологии последовательностей (Vanoosthuyse et al., 2001; Олсен и др., 2002; Вен и др., 2004).

Каковы возможные причины снижения частоты аннотирования малых генов? Гены обнаруживаются с помощью комбинации компьютерных программ для поиска генов, которые анализируют последовательности геномной ДНК, секвенирование кДНК и характеристику мутантов. При компьютерной идентификации генов, чтобы свести к минимуму неправильное предсказание того, что случайные маленькие открытые рамки считывания (ORF) являются генами, общепринятой практикой является игнорирование ORF меньше определенного размера без эмпирических доказательств экспрессии (т. е. тег экспрессируемой последовательности или комплементарная ДНК). Эта практика направлена ​​​​на оптимизацию отношения сигнал-шум при поиске генов, отражая то, что вероятность случайного возникновения ложной ORF в геноме увеличивается по мере уменьшения размера ORF. Смещение также является результатом методов, используемых для создания библиотек кДНК, которые обычно используют этап отбора по размеру молекулы для исключения кДНК размером менее 400–500 п.н. Генетические скрининги потенциально могут выявить маленькие гены; однако небольшой размер гена будет препятствовать его открытию, уменьшая вероятность мутагенного события, происходящего в этом гене.В сочетании эти факторы способствуют занижению сведений о генах, кодирующих малые пептиды, в аннотациях генома.

Основываясь на вышеупомянутых рассуждениях, мы предположили, что еще предстоит открыть дополнительные малые гены, кодирующие пептиды. Мы использовали биоинформационные подходы как для получения дополнительных доказательств того, что небольшие пептиды недостаточно аннотированы, так и для идентификации генов-кандидатов, кодирующих пептиды, которые в настоящее время не аннотированы.

РЕЗУЛЬТАТЫ

Частоты длин белков указывают на то, что малые белки могут быть недостаточно аннотированы

Одно из ожиданий, что если малые гены, кодирующие пептиды, недостаточно аннотированы у арабидопсиса, будет иметь место перекос в частотном распределении длин белков.Чтобы оценить, существует ли несоответствие в количестве аннотированных белков разной длины, мы построили график частоты аннотированных белков Arabidopsis Information Resource (TAIR) 6.0 в зависимости от длины после помещения их в ячейки шириной 50 аминокислот () . Этот график показывает существенное снижение количества малых белков менее 101 аминокислоты, особенно менее 51 аминокислоты. Это еще более поразительно, если учесть, что количество теоретически возможных ORF увеличивается экспоненциально по мере уменьшения размера разрешенного ORF (Basrai et al., 1997). Наблюдаемое распределение может либо отражать биологическую основу (т. е. действительно относительно меньше генов, кодирующих малые белки в геноме арабидопсиса), либо указывать на недостаточную аннотацию генов, кодирующих малые белки.

На гистограмме аннотированных длин белков арабидопсиса наблюдается асимметричное распределение. Длины 30 690 белков, аннотированных в TAIR 6.0, были оценены с использованием сценария Perl и помещены в ячейки шириной 50 аминокислот. Были построены бины, содержащие белки до 750 аминокислот.

Биоинформационный подход к идентификации неаннотированных секретируемых пептидов

Поскольку нас интересует межклеточная передача сигналов, мы сосредоточились на небольших генах, кодирующих пептиды, которые, вероятно, будут секретироваться. Мы написали Perl-скрипты для автоматизации процесса идентификации неаннотированных пептидов арабидопсиса и последовательной фильтрации, результаты которых обобщены в . Во-первых, мы проверили все пять хромосом арабидопсиса на обеих цепях на наличие всех ORF, кодирующих белки длиной от 25 до 250 аминокислот.Основанием для скрининга ORF было то, что многие известные растительные пептиды, которые, как считается, функционируют в межклеточной передаче сигналов, кодируются одноэкзонными генами. Например, все семейство генов, связанных с CLV3/ESR (CLE) (кроме CLV3 и CLE40; Cock and McCormick, 2001; Sharma et al., 2003), семейство генов, подобных фактору быстрого подщелачивания (RALFL) (Olsen et al. al., 2002), семейство дефицитных по опадению соцветий (IDA) (Бутенко и др., 2003), семейство DEVIL (Wen et al., 2004), семейство LCR (Vanoosthuyse et al., 2001), и семейство SCRL (Vanoosthuyse et al., 2001) являются одноэкзонными генами. Также стоит отметить, что одноэкзонные гены являются наиболее часто наблюдаемой структурой генов арабидопсиса (Александров и др., 2006). Нижний предел размера основан на идее о том, что длина среднего сигнального пептида составляет 22 аминокислоты (Bendtsen et al., 2004b), а также на знании того, что существуют биоактивные растительные пептиды длиной не более пяти аминокислот (Matsubayashi and Sakagami, 1996). . Верхний предел размера был установлен на уровне 250 аминокислот, исходя из предшественника системы томата ( Lycopersicon esculentum ), крупнейшего известного сигнального пропротеина длиной 200 аминокислот, чтобы обеспечить некоторую толерантность. Скрининг генома арабидопсиса с этими ограничениями привел к идентификации 606 285 ORF.

Таблица I.

Биоинформационная идентификация и фильтрация ОРС, кодирующих пептид арабидопсиса

Хромосома арабидопсиса № идентифицированных ОРС 25–250 Аминокислот по порядку после фильтра 0 № 9
0
Удерживая более крупные ORFS при перекрытии в рамках ORFS Наличие сигналов 3NN Прогнозируемого расщепленного аминосодержащего сигнала Peptide Отсутствие TMHMM2 прогнозировало мембранные домены Отсутствие KDEL или HDL C Конец За пределами диапазона генов ТАИР 6. 0 Аннотированные Гены
1 153649 120233 +21253 19811 19810 8214
2 99714 78754 13935 13022 13022 6289
3 121487 94968 16324 15327 15327 6812
4 94585 74185 12713 11904 11904 5301
5 136850 107141 18472 17206 17206 7193
Итого 606285 475281 82697 77270 77269 33809

Далее мы удалили меньшие ORF, если m были восстановлены несколько перекрывающихся ORF внутри кадра, в результате чего была сохранена 475 281 ORF. Предсказанные пептиды и малые белки подвергали скринингу на присутствие предсказанных амино-концевых сигнальных пептидов, которые направляли бы их на секреторный путь, с использованием версии SignalP 3.0 для нейронной сети (Bendtsen et al., 2004b). Это уменьшило количество ORF до 82 697.

Затем мы провели скрининг на отсутствие трансмембранных спиралей, которые могли бы указывать на то, что белок находится в плазматической мембране или эндомембране секреторного пути, используя TMHMM 2.0 (Krogh et al., 2001), сохранив 77 270 ORF.Мы также исключили возможный резидентный белок просвета эндоплазматического ретикулума, удалив белки, имеющие мотивы KDEL или HDEL на их С-концах (удалена одна последовательность). Наконец, мы провели скрининг ORF, которые перекрывают координаты генов, аннотированных в выпуске аннотированного генома TAIR 6.0, что привело к окончательной идентификации 33 809 предполагаемых ORF.

Биоинформатические подходы к проверке предполагаемых ORF

Мы сосредоточились на трех свойствах предсказанных ORF, которые можно оценить с помощью биоинформатики для предсказания ORF. Первое ожидание функционального гена состоит в том, что он транскрибируется. Мы использовали опубликованные данные, полученные в экспериментах по тайлинговой гибридизации всего генома (Yamada et al., 2003), чтобы предоставить доказательства экспрессии ORF. В частности, мы проверили, была ли интенсивность гибридизации как минимум в два раза выше среднего значения сигнала чипа. Исходя из этого, из анализа наборов данных клеток корней, листьев, цветов и суспензии мы обнаружили доказательства экспрессии 10 247 предполагаемых ОРС.

Поскольку большинство известных генов, кодирующих пептиды, принадлежат к семействам генов, вторая используемая прогностическая мера заключалась в том, что предполагаемые пептиды, которые кодируются семействами генов, с большей вероятностью будут достоверными.Мы использовали BLASTCLUST (Altschul et al., 1990) для выполнения односвязной кластеризации препропротеинов (белок с его сигнальным пептидом). Этот анализ показал, что 3324 пептида принадлежат к 974 кластерам из двух или более пептидов.

В-третьих, мы пришли к выводу, что предполагаемые ОРС с большей вероятностью представляют гены, если в геноме риса ( Oryza sativa ) можно найти ортолог. Используя tBLASTn с параметрами по умолчанию, было обнаружено, что 15 975 предполагаемых ОРС соответствуют геному риса.Этот порог был выбран для учета чувствительности, учитывая короткую длину пептидов.

Оценка степени перекрытия этих трех типов аннотационных данных показала, что 1044 предсказанных ORF поддерживаются всеми тремя, а еще 6042 предсказанных ORF поддерживаются любыми двумя из трех ().

Диаграмма Венна, показывающая степень перекрытия данных аннотаций, подтверждающих предсказанные пептиды.

Обратная транскрипция-ПЦР показывает экспрессию подмножества тестируемых ORF

Мы выбрали 25 ORF случайным образом из коллекции ORF, имеющих подтверждающие данные из всех трех классов аннотационных данных для тестирования с помощью обратной транскрипции (RT)-PCR.Учитывая, что многие гены проявляют дифференциальную экспрессию, мы раздельно выделили РНК из 2-недельных корней, 3-недельных розеточных листьев, центральных надземных частей 2-недельных растений (для получения вегетативной меристемы), цветков и стручков. . Отсутствие интронов в ORF не позволяло использовать праймеры, граничащие с интроном, в качестве защиты от контаминации амплифицирующей геномной ДНК. Были приняты две альтернативные меры, чтобы избежать и контролировать возможность амплификации загрязнения геномной ДНК.Во-первых, мы обработали РНК ДНКазой перед синтезом кДНК, чтобы удалить любые следы геномной ДНК. Во-вторых, мы организовали фиктивную реакцию синтеза кДНК для каждой РНК, в которой не добавлялась обратная транскриптаза. Реакции ПЦР с использованием аликвот ложных реакций кДНК использовали в качестве матрицы для демонстрации того, что продукты ПЦР являются зависимыми от обратной транскриптазы. В результате этих экспериментов мы обнаружили доказательства экспрессии пяти из 25 протестированных ОРС (4). Ожидаемые продукты ПЦР могли быть получены со всеми 25 парами праймеров с использованием геномной ДНК в качестве матрицы, что указывает на то, что невозможность обнаружения экспрессии с помощью матрицы кДНК не была связана с условиями ПЦР, конструкцией праймеров или синтезом (данные не показаны). Используемые ORF и праймеры, которые не свидетельствовали об экспрессии, представлены в дополнительной таблице S1.

Результаты ОТ-ПЦР, показывающие экспрессию неаннотированных ОРС. переулок 1, корень; полоса 2, лист; дорожка 3 — вегетативная меристема; полоса 4, цветок; дорожка 5, фрукты; дорожка 6, водный отрицательный контроль; дорожка 7, положительный контроль геномной ДНК. Звездочками отмечены продукты ПЦР. Ген-специфические праймеры At3g54350 использовали в качестве положительного контроля для синтеза кДНК первой цепи и охватывают два интрона, давая продукты разного размера для геномных матриц и матриц кДНК.Димеры праймеров видны ниже продуктов ПЦР.

Веб-интерфейс с возможностью поиска для распространения набора данных пептидома арабидопсиса

Была создана реляционная база данных MySQL с информацией о 33 809 ORF. Пептиды были названы с префиксом ath_mu для обозначения предсказаний Arabidopsis и Университета Миссури. После этого префикса в имени содержится хромосома, номер предсказания и цепь (например, ath_mu_ch2_20337top). Был разработан веб-интерфейс, который позволяет запрашивать в базе данных подмножества предсказанных пептидов на основе различных критериев отбора (4).Адрес веб-сайта: http://peptidome.missouri.edu. Данные могут быть получены либо в табличном формате в окне веб-браузера, либо могут быть загружены на рабочий стол в формате с разделителями табуляцией, который можно открыть в Microsoft Excel.

Снимок экрана веб-интерфейса базы данных неаннотированных секретируемых пептидов Arabidopsis.

Идентифицированы новые члены семейства RALFL

Мы использовали поиск по гомологии последовательностей, чтобы проверить наличие каких-либо пептидов, сходных с известными растительными пептидами, в базе данных неаннотированных секретируемых пептидов Arabidopsis.Мы идентифицировали членов нескольких известных семейств растительных пептидов. Например, было обнаружено 12 предполагаемых генов RALFL (Pearce et al., 2001b; Olsen et al., 2002). Из этих 12 10 были зарегистрированы ранее (Olsen et al. , 2002), но не включены в самую последнюю версию аннотации генома арабидопсиса. Список этих ORF приведен в дополнительной таблице S2. Были идентифицированы два дополнительных гена RALFL (ath_mu_ch2_20831bottom, ath_mu_ch2_21704top), о которых ранее не сообщалось, что увеличило количество генов RALFL у арабидопсиса с 34 до 36 (10).

ClustalW (Thompson et al., 1994) множественное выравнивание последовательностей RALFL 6, ath_mu_ch2_21704top и ath_mu_ch2_20831bottom. Идентичные остатки отмечены звездочками.

Кроме того, недавнее дополнение к семейству CLE, CLE45 (Strabala et al., 2006), было обнаружено в базе данных как ath_mu_ch2_65447top. Кроме того, ath_mu_ch2_59545bottom проявляет сходство с доменом CLE CLE26 и может представлять собой незарегистрированный CLE.

Хотя они были описаны Butenko et al.(2003), четыре соцветия с дефицитом абсциссоподобных (IDL) членов еще не были добавлены в официальную аннотацию генов арабидопсиса и были идентифицированы в нашей базе данных (ath_mu_ch5_65848top [IDL2], ath_mu_ch5_8150top [IDL3], ath_mu_ch4_17023top [IDL4] и ath_mu_ch2_4155bottom [IDL5]). Наконец, в этой базе данных есть ORF, кодирующие пептиды, которые имеют высокое сходство последовательностей с аннотированными пептидами риса (дополнительная рис. S1).

ОБСУЖДЕНИЕ

База данных неаннотированных секретируемых пептидов Arabidopsis должна быть полезна для исследователей, занимающихся различными вопросами.Во-первых, исследователям, изучающим пептидную биологию, будет полезен список пептидов-кандидатов для исследования. Учитывая, что в растениях существуют сотни рецепторов поверхности орфанных клеток, этот ресурс может облегчить идентификацию пар рецептор-лиганд. Во-вторых, группы, выполняющие позиционное клонирование мутантных генов или мечение активации, выиграют от наличия дополнительных генов-кандидатов для тестирования в пределах интервала картирования или вблизи места вставки Т-ДНК. В-третьих, этот ресурс может быть полезен исследователям протеомики, поскольку известное программное обеспечение для идентификации белков, такое как MASCOT (Perkins et al. , 1999), требуется, чтобы белок или пептид был в базе данных для установления соответствия.

Общий подход, использованный для создания этого набора данных, заключался в обеспечении более высокой чувствительности для обнаружения ORF за счет более низкой селективности. Основываясь как на данных биоинформатики, так и на данных ОТ-ПЦР, мы подсчитали, что существует от сотен до нескольких тысяч неаннотированных малых генов. Возможное объяснение способности амплифицировать только одну пятую протестированных ORF может заключаться в том, что они имеют чрезвычайно низкое количество и для обнаружения потребуется кДНК, полученная из мРНК, а не общая РНК.В качестве альтернативы, эти ORF могут быть индуцированы при определенных обстоятельствах, которые не были проверены в этом исследовании. Или может быть просто так, что ORF, которые не смогли амплифицироваться, не являются генами.

Несоответствие в обнаружении экспрессии ORF с помощью RT-PCR и прогнозов экспрессии на основе данных мозаичного массива, вероятно, связано с проблемами отношения сигнал/шум. Если изучить интенсивность гибридизации многих аннотированных генов арабидопсиса, то можно увидеть значительные различия в интенсивности гибридизации даже в пределах одного экзона (Yamada et al., 2003). Поскольку ORF, рассматриваемые в этой работе, малы, различение сигнала над шумом не является тривиальным. Использование данных тайлинга для исследования небольшой экспрессии ORF является ценным, но данные необходимо интерпретировать с учетом экспериментальных ограничений. По мере того, как этот ресурс будет использоваться сообществом и будут проверены дальнейшие прогнозы, оценка количества и разнообразия пептидов из неаннотированных малых генов станет более ясной.

Поскольку этот ресурс основан на идентификации секретируемых пептидов, выбор программ прогнозирования сигнальных пептидов и трансмембранных доменов был важен для получения оптимальных результатов.Были использованы SignalP 3NN и TMHMM 2.0, поскольку было показано, что они являются лучшими программами для обнаружения эукариотических сигнальных пептидов и трансмембранных доменов, соответственно (Moller et al. , 2001; Bendtsen et al., 2004b). Требование положительного прогноза от нескольких программ прогнозирования имеет ценность как альтернативный подход; однако, хотя это уменьшит количество ложноположительных результатов, это также вызовет больше ложноотрицательных ошибок.

Наш подход имеет некоторые ограничения. Пептиды, кодируемые неаннотированными генами с несколькими экзонами, не представлены.Кроме того, не включены те пептиды, которые продуцируются ограниченным протеолизом более крупного предшественника. Очищенные биоактивные растительные пептиды предполагают, что ограниченный протеолиз является важным источником образования пептидов (McGurl et al., 1992; Matsubayashi and Sakagami, 1996; Pearce et al., 2001a, 2001b; Huffaker et al., 2006; Ito et al. и др., 2006; Кондо и др., 2006). В настоящее время мы не можем ни предсказать, какие белки, кодируемые растениями, будут подвергаться этому процессингу, ни какими будут пептидные продукты.По мере биохимической идентификации большего количества пептидов правила образования растительных пептидов из предшественников, вероятно, станут более очевидными. Кроме того, в этой базе данных не представлены пептиды с предшественниками, у которых отсутствует сигнальный пептид. Наконец, транспозоны часто обнаруживаются в межгенных областях, и подмножество пептидов в базе данных, вероятно, является концептуальной трансляцией последовательностей транспозонов. Эти артефакты обычно можно обнаружить, просматривая колонку BLASTp на наличие пептида, чтобы увидеть, проявляет ли он сходство последовательности с белками, кодируемыми транспозонами.

Другими потенциальными источниками внеклеточных пептидов, которые исключены из базы данных, являются те, которые секретируются неклассическим путем. Имеются доказательства существования в животных системах белков, в которых отсутствуют сигнальные пептиды, но известно, что они являются внеклеточными (Bendtsen et al., 2004a). У растений также может существовать неклассический секреторный путь. Например, в предшественниках системина и AtPep1 отсутствуют сигнальные пептиды, однако эти пептиды взаимодействуют с рецепторами клеточной поверхности (McGurl et al. , 1992; Шеер и Райан, 2002 г .; Хаффакер и др., 2006 г.; Ямагучи и др., 2006). Во-вторых, протеомные эксперименты, в которых была охарактеризована клеточная стенка или апопласт, выявили (в дополнение к белкам, предшественники которых содержат сигнальные пептиды) многие белки, в которых отсутствуют сигнальные пептиды (Watson et al., 2004; Boudart et al., 2005; Chivasa et al. ., 2005; Квон и др., 2005). Неясно, указывают ли наблюдения протеомики на примеси из используемых процедур субклеточного фракционирования или на альтернативный секреторный путь (Jamet et al., 2006).

Идентификация генов является необходимым условием для исследования генов в эпоху геномики. База данных неаннотированных секретируемых пептидов Arabidopsis способствует решению проблемы недостаточной аннотации малых генов и предлагает новые потенциальные медиаторы межклеточной коммуникации у растений, которые должны улучшить наше понимание биологии растений.

МАТЕРИАЛЫ И МЕТОДЫ

Биоинформатика

Для расчета частот длин белков были загружены аннотированные белки TAIR 6. 0 в формате FASTA (ftp://ftp.arabidopsis.org/home/tair/Genes/TAIR6_genome_release/TAIR6_pep_20051108). Был написан Perl-скрипт для подсчета количества аминокислот в каждом белке и подсчета частоты длин белков. Эти данные были импортированы в Microsoft Excel, и подсчеты длин белков суммировались в ячейках по 50 аминокислот (например, 1–50, 51–100 и т. д.). Эти подсчеты бинов были нанесены на график как функция размеров белка, представленных каждым бином.

Для анализа данных массива листов SALK мы получили наборы данных массива листов (Yamada et al., 2003) из анализа экспрессии образцов корней, суспензионных клеток, листьев и цветков (наборы данных любезно предоставлены Т. Джоши и Д. Сюй, Университет Миссури). Следующие шаги были выполнены с использованием пользовательских сценариев Perl. Мы удалили из рассмотрения нерелевантные функции (например, элементы управления Affymetrix), а также функции, которые не были уникальными (точная последовательность функций, встречающаяся на чипах более одного раза). Мы определили среднее значение для каждого чипа для экспериментов с корнем, листом, подвесной клеткой и цветком.Мы проверили функции, которые были больше или равны удвоенному среднему значению каждого чипа. Затем мы искали точное совпадение полной длины последовательности признаков зонда в последовательностях ORF. В базе данных мы сообщаем данные зонда (необработанная интенсивность), соответствующие этим критериям для каждой ORF. Показанная последовательность признаков является обратным дополнением фактической последовательности зондов.

20-нуклеотидный сигнатурный набор данных Arabidopsis ( Arabidopsis thaliana ) массивно-параллельного сигнатурного секвенирования (MPSS) из базы данных MPSS лаборатории Мейерса (Nakano et al., 2006) был загружен (http://mpss.udel.edu/at/public_data/20bp/20bp_summary.txt). Сигнатуры класса 4 (межгенные сигнатуры) были получены из набора данных, и позиции сигнатур класса 4 были сопоставлены с ORF базы данных, чтобы идентифицировать 177 поддерживающих сигнатур.

Поиски BLASTp проводились с использованием параметров по умолчанию (Altschul et al., 1990) с препропротеинами в качестве запросов и базы данных растительных белков (полученной с ftp://ftp.arabidopsis.org/home/tair/Sequences/blast_datasets/PlantProtein.Z), показывающий 10 лучших попаданий, количество попаданий и значения e. tBLASTn с предсказанными препропротеинами, запрашивающими рис ( Oryza sativa cv japonica ), сборка хромосом версии 4.0 Института геномных исследований (TIGR; база данных BLAST, созданная на основе псевдохромосом, полученных с http://www.tigr.org/tdb) /e2k1/osa1/pseudomolecules/info.shtml), показать лучшие хиты. Кластеризация одиночной связи была выполнена с использованием BLASTCLUST (Altschul et al., 1990) с предсказанными препропротеинами.Чтобы упростить интерпретацию данных кластера базы данных, первое число — это номер кластера, а число в скобках — количество членов в этом кластере.

ORF и соответствующие данные аннотаций были помещены в реляционную базу данных MySQL с интерфейсом веб-интерфейса с возможностью поиска с использованием модулей Perl DBI и CGI. База данных неаннотированных секретируемых пептидов Arabidopsis находится в открытом доступе на http://peptidome.missouri.edu.

ОТ-ПЦР

Тотальную РНК выделяли из растений арабидопсиса экотипа Колумбия с использованием мини-набора для растений Qiagen RNeasy в соответствии с инструкциями производителя (Qiagen).Для выделения корневой РНК использовали двухнедельные корни растений, выращенных на чашках с половинным агаром Мурасиге и Скуга под 100 мк моль м -2 с -1 желтого света. РНК листьев выделяли из розеточных листьев 3-недельных растений, выращенных в почве. Ткань вегетативной меристемы выделяли из центральных надземных частей 2-недельных растений, выращенных в почве. Цветы и плоды были получены из 3,5-недельных растений, выращенных в почве. Выделенную РНК обрабатывали турбо-ДНКазой в соответствии с инструкциями производителя для удаления любых следовых количеств геномной ДНК (Ambion).Концентрацию РНК определяли количественно с помощью спектрофотометра с нанокапли. Один микрограмм РНК использовали для получения олиго(dT)-примированной кДНК первой цепи с помощью набора для синтеза кДНК Omniscript в соответствии с инструкциями производителя (Qiagen). В качестве альтернативы проводили контрольные реакции, в которых обратную транскриптазу заменяли водой на контрольную матрицу, чтобы исключить загрязнение геномной ДНК. Десять процентов (2 мкл л) объема реакций кДНК использовали для 25- мк л ПЦР-реакций с использованием геноспецифических праймеров для 25 ОРС, которые подтверждались тремя биоинформационными данными (данные о фрагментах экспрессии принадлежали кластер и имел совпадение с геномом риса).Праймеры были разработаны для амплификации всей ORF. ПЦР-буфер TaKaRa (содержащий 1,5 мМ MgCl 2 в конечной концентрации), 200 мк м dNTP и полимеразу Taq использовали для ПЦР. Условия ПЦР были следующими: 95°С в течение 5 мин, затем 36 циклов: 94°С в течение 30 с, 50°С в течение 30 с и 72°С в течение 1 мин. Продукты ПЦР разделяли на агарозных гелях, содержащих 4% (вес/объем) бромистого этидия, и фотографировали. Праймеры, используемые для ORF, и управления в стали: ath_mu_ch2_20337top ЗА: ATGGCAACTCAAGTGTCAAAGAAAATC, ath_mu_ch2_20337top REV: TTAAGCGGTACAAATCCAGCTAAATGC, ath_mu_ch2_22982bottom ДЛЯ: ATGGCGCCTCAAACAATGAAAAAGAT, ath_mu_ch2_22982bottom REV: TTATTTTGGTTTTTTACATAGCCACCAC, ath_mu_ch4_26410top ДЛЯ: ATGAAACAATTGTTAGTCTTTCTATTTG, ath_mu_ch4_26410top REV: TTAATAAATCCAATCATACTCTTTATGC, ath_mu_ch5_4517top ДЛЯ: ATGCAAACTCATAGGTTGTATCGAAT, ath_mu_ch5_4517top REV: CTAACCGTTTATGAGGTTCTTTCCTA .

Дополнительные данные

Следующие материалы доступны в онлайн-версии этой статьи.

  • Дополнительный рисунок S1. Четыре примера неаннотированных пептидов арабидопсиса, совмещенных с их аннотированными родственниками риса.

  • Дополнительная таблица S1. Праймеры, используемые для ОТ-ПЦР ORF, экспрессия которых не была обнаружена.

  • Дополнительная таблица S2. Ранее идентифицированные пептиды RALFL в базе данных неаннотированных секретируемых пептидов Arabidopsis.

Благодарности

Мы благодарим Алана Маршалла и Джоша Хартли за помощь с сервером, Трупти Джоши и Донг Сю за помощь с данными массива листов, Билла Споллена и Гордона Спрингера за помощь в отправке заданий BLAST в исследовательском кластере Walker lab за предложения по веб-интерфейсу и рукописи, анонимных рецензентов за полезные отзывы и Джима Бернетта за знакомство с программированием на Perl.

Литература

  • Александров Н.Н., Трухан М.Е., Бровер В.В., Татаринова Т., Флавелл Р.Б., Фельдманн К.А. (2006) Особенности генов и генома арабидопсиса, обнаруженные с использованием полноразмерных кДНК.Plant Mol Biol 60 : 69–85 [PubMed] [Google Scholar]
  • Altschul SF, Gish W, Miller W, Myers EW, Lipman DJ (1990) Базовый инструмент поиска локального выравнивания. J Mol Biol 215 : 403–410 [PubMed] [Google Scholar]
  • Basrai MA, Hieter P, Boeke JD (1997) Маленькие открытые рамки для чтения: красивые иголки в стоге сена. Genome Res 7 : 768–771 [PubMed] [Google Scholar]
  • Bendtsen JD, Jensen LJ, Blom N, Von Heijne G, Brunak S (2004.а) Предсказание на основе признаков неклассической и беслидерной секреции белков. Protein Eng Des Sel 17 : 349–356 [PubMed] [Google Scholar]
  • Bendtsen JD, Nielsen H, von Heijne G, Brunak S (2004. b) Улучшенное предсказание сигнальных пептидов: SignalP 3.0. J Mol Biol 340 : 783–795 [PubMed] [Google Scholar]
  • Boudart G, Jamet E, Rossignol M, Lafitte C, Borderies G, Jauneau A, Esquerre-Tugaye MT, Pont-Lezica R (2005) ) Белки клеточной стенки в апопластных жидкостях розеток Arabidopsis thaliana: идентификация методами масс-спектрометрии и биоинформатики.Proteomics 5 : 212–221 [PubMed] [Google Scholar]
  • Бутенко М.А., Паттерсон С.Е., Грини П.Е., Стенвик Г.Е., Амундсен С.С., Мандал А., Аален Р.Б. в Arabidopsis и идентифицирует новое семейство предполагаемых лигандов в растениях. Plant Cell 15 : 2296–2307 [бесплатная статья PMC] [PubMed] [Google Scholar]
  • Chivasa S, Simon WJ, Yu XL, Yalpani N, Slabas AR (2005) Патогенные элиситорные изменения во внеклеточном пространстве кукурузы матричный протеом.Proteomics 18 : 4894–4904 [PubMed] [Google Scholar]
  • Cobbett C, Goldsbrough P (2002) Фитохелатины и металлотионеины: роль в детоксикации тяжелых металлов и гомеостазе. Annu Rev Plant Biol 53 : 159–182 [PubMed] [Google Scholar]
  • Cock JM, McCormick S (2001) Большое семейство генов, имеющих гомологию с CLAVATA3. Plant Physiol 126 : 939–942 [бесплатная статья PMC] [PubMed] [Google Scholar]
  • Fletcher JC, Brand U, Running MP, Simon R, Meyerowitz EM (1999) Сигнализация решений клеточной судьбы с помощью CLAVATA3 в Меристемы побегов арабидопсиса.Science 283 : 1911–1914 [PubMed] [Google Scholar]
  • Garcia-Olmedo F, Molina A, Alamillo JM, Rodriguez-Palenzuela P (1998) Защитные пептиды растений. Biopolymers 47 : 479–491 [PubMed] [Google Scholar]
  • Huffaker A, Pearce G, Ryan CA (2006) Эндогенный пептидный сигнал у Arabidopsis активирует компоненты врожденного иммунного ответа. Proc Natl Acad Sci USA 103 : 10098–10103 [бесплатная статья PMC] [PubMed] [Google Scholar]
  • Ito Y, Nakanomyo I, Motose H, Iwamoto K, Sawa S, Dohmae N, Fukuda H (2006) ) Пептиды Dodeca-CLE как супрессоры дифференцировки стволовых клеток растений.Science 313 : 842–845 [PubMed] [Google Scholar]
  • Jamet E, Canut H, Boudart G, Pont-Lezica RF (2006) Белки клеточной стенки: новое понимание протеомики. Trends Plant Sci 11 : 33–39 [PubMed] [Google Scholar]
  • Kondo T, Sawa S, Kinoshita A, Mizuno S, Kakimoto T, Fukuda H, Sakagami Y (2006) Растительный пептид, кодируемый CLV3 идентифицированы in situ анализом MALDI-TOF MS. Science 313 : 845–848 [PubMed] [Google Scholar]
  • Крог А. , Ларссон Б., фон Хейне Г., Зоннхаммер Э.Л. (2001) Прогнозирование топологии трансмембранных белков с помощью скрытой марковской модели: приложение к полным геномам.J Mol Biol 305 : 567–580 [PubMed] [Google Scholar]
  • Kwon HK, Yokoyama R, Nishitani K (2005) Протеомный подход к апопластным белкам, участвующим в регенерации клеточной стенки в протопластах суспензионного культивирования Arabidopsis клетки. Plant Cell Physiol 46 : 843–857 [PubMed] [Google Scholar]
  • Matsubayashi Y, Sakagami Y (1996) Фитосульфокин, сульфатированные пептиды, которые вызывают пролиферацию одиночных клеток мезофилла Asparagus officinalis L.Proc Natl Acad Sci USA 93 : 7623–7627 [бесплатная статья PMC] [PubMed] [Google Scholar]
  • Matsubayashi Y, Takagi L, Omura N, Morita A, Sakagami Y (1999) Эндогенный сульфатированный пентапептид фитосульфокин – α стимулирует дифференцировку трахеальных элементов изолированных клеток мезофилла циннии. Plant Physiol 120 : 1043–1048 [Статья бесплатно PMC] [PubMed] [Google Scholar]
  • McGurl B, Pearce G, Orozco-Cardenas M, Ryan CA (1992) Structure, expression, and antisense ген-предшественник системы.Science 255 : 1570–1573 [PubMed] [Google Scholar]
  • Moller S, Croning MD, Apweiler R (2001) Оценка методов прогнозирования областей, охватывающих мембрану. Bioinformatics 17 : 646–653 [PubMed] [Google Scholar]
  • Nakano M, Nobuta K, Vemaraju K, Tej SS, Skogen JW, Meyers BC (2006) Базы данных MPSS растений: ресурсы транскрипции на основе сигнатур для анализа мРНК и малых РНК. Nucleic Acids Res 34 : D731–D735 [статья бесплатно PMC] [PubMed] [Google Scholar]
  • Олсен А.Н., Манди Дж., Скривер К. (2002) Пептомика, идентификация новых катионных пептидов арабидопсиса с консервативными мотивами последовательности.In Silico Biol 2 : 441–451 [PubMed] [Google Scholar]
  • Pearce G, Moura DS, Stratmann J, Ryan CA (2001. а) Производство нескольких растительных гормонов из одного полипротеинового предшественника. Nature 411 : 817–820 [PubMed] [Google Scholar]
  • Pearce G, Moura DS, Stratmann J, Ryan CA (2001). разработка. Proc Natl Acad Sci USA 98 : 12843–12847 [бесплатная статья PMC] [PubMed] [Google Scholar]
  • Perkins DN, Pappin DJ, Creasy DM, Cottrell JS (1999) Вероятностная идентификация белка путем поиска последовательности базы данных с использованием данных масс-спектрометрии.Электрофорез 20 : 3551–3567 [PubMed] [Google Scholar]
  • Scheer JM, Ryan CA (2002) Системиновый рецептор SR160 из Lycopersicon peruvianum является членом семейства рецепторных киназ LRR. Proc Natl Acad Sci USA 99 : 9585–9590 [бесплатная статья PMC] [PubMed] [Google Scholar]
  • Schopfer CR, Nasrallah ME, Nasrallah JB (1999) Мужской детерминант самонесовместимости у Brassica. Science 5445 : 1697–1700 [PubMed] [Google Scholar]
  • Sharma VK, Ramirez J, Fletcher JC (2003) CLV3-подобные (CLE) гены Arabidopsis экспрессируются в различных тканях и кодируют секретируемые белки.Plant Mol Biol 51 : 415–425 [PubMed] [Google Scholar]
  • Страбала Т.Дж., О’Доннелл П.Дж., Смит А.М., Ампомах-Двамена С., Мартин Э.Дж., Нетцлер Н., Ньювенхуизен Н.Дж., Куинн Б.Д., Фут Х.К. , Hudson KR (2006). Фенотипы приобретения функции многих генов CLAVATA3/ESR, включая четыре новых члена семейства, коррелируют с тандемными вариациями в консервативном домене CLAVATA3/ESR. Plant Physiol 140 : 1331–1344 [бесплатная статья PMC] [PubMed] [Google Scholar]
  • Такаяма С., Шиба Х., Ивано М., Симосато Х., Че Ф.С., Кай Н., Ватанабэ М., Судзуки Г., Хината К. , Isogai A (2000) Пыльца, определяющая самонесовместимость у Brassica campestris.Proc Natl Acad Sci USA 97 : 1920–1925 [бесплатная статья PMC] [PubMed] [Google Scholar]
  • Thompson JD, Higgins DG, Gibson TJ (1994) CLUSTALW: повышение чувствительности последовательного множественного выравнивания посредством взвешивание последовательности, штрафы за пробелы для конкретных позиций и выбор матрицы весов. Nucleic Acids Res 22 : 4673–4680 [бесплатная статья PMC] [PubMed] [Google Scholar]
  • Vanoosthuyse V, Miege C, Dumas C, Cock JM (2001) Два больших семейства генов Arabidopsis thaliana гомологичны Надсемейство генов Brassica, которое кодирует белки пыльцевой оболочки и мужской компонент реакции самонесовместимости.Plant Mol Biol 46 : 17–34 [PubMed] [Google Scholar]
  • Watson BS, Lei Z, Dixon RA, Sumner LW (2004) Протеомика клеточных стенок Medicago sativa. Phytochemistry 65 : 1709–1720 [PubMed] [Google Scholar]
  • Wen J, Lease KA, Walker JC (2004) DVL, новый класс малых полипептидов: сверхэкспрессия изменяет развитие арабидопсиса. Plant J 37 : 668–677 [PubMed] [Google Scholar]
  • Yamada K, Lim J, Dale JM, Chen H, Shinn P, Palm CJ, Southwick AM, Wu HC, Kim C, Nguyen M, et al (2003) Эмпирический анализ транскрипционной активности в геноме арабидопсиса. Science 302 : 842–846 [PubMed] [Google Scholar]
  • Yamaguchi Y, Pearce G, Ryan CA (2006) Рецептор клеточной поверхности, богатый лейцином, для AtPep1, эндогенного пептидного элиситора у арабидопсиса, является функциональным. в трансгенных клетках табака. Proc Natl Acad Sci USA 103 : 10104–10109 [бесплатная статья PMC] [PubMed] [Google Scholar]

Взаимосвязь между содержанием хлорофилла в листьях и спектральной отражательной способностью и алгоритмы неразрушающей оценки хлорофилла в листьях высших растений

https: //дои.org/10.1078/0176-1617-00887Получить права и содержание

Резюме

Содержание хлорофилла в листьях дает ценную информацию о физиологическом состоянии растений. Измерение коэффициента отражения позволяет быстро и неразрушающим образом оценить in situ содержание хлорофилла в листьях. Наша цель состояла в том, чтобы исследовать спектральное поведение взаимосвязи между отражательной способностью и содержанием хлорофилла и разработать метод неразрушающей оценки хлорофилла в листьях с широким диапазоном содержания и состава пигмента с использованием отражательной способности в нескольких широких спектральных диапазонах. Исследована спектральная отражательная способность листьев клена, каштана, дикого винограда и бука в широком диапазоне содержания и состава пигментов. Показано, что обратная отражательная способность (R < ) -1 в спектральном диапазоне λ от 520 до 550 нм и от 695 до 705 нм тесно связана с общим содержанием хлорофилла в листьях всех видов. Вычитание обратного коэффициента отражения в ближней инфракрасной области, (R NIR ) -1 , из (R < ) -1 составило индекс [(R < ) -1 – (R

5 NIR ) −1 ] линейно пропорциональна общему содержанию хлорофилла в спектральных диапазонах λ от 525 до 555 нм и от 695 до 725 нм с коэффициентом детерминации r 2 ≫ 0.94. Чтобы скорректировать различия в структуре листа, произведение последнего индекса и коэффициента отражения NIR [(R λ ) -1 – (R NIR ) -1 ]*(R NIR ) было использовал; это дополнительно повысило точность определения хлорофилла в диапазоне λ от 520 до 585 нм и от 695 до 740 нм. Для проверки разработанных алгоритмов использовались два независимых набора данных. Среднеквадратическая ошибка предсказания хлорофилла не превышала 50 мкмоль/м 90 253 2 90 254 в листьях с общим содержанием хлорофилла от 1 до 830 мкмоль/м 90 253 2 90 254 .

Ключевые слова

хлорофиллы

неразрушающий контроль

оптика листьев

отражательная способность

Рекомендуемые статьиСсылки на статьи (0)

Посмотреть полный текст

Copyright © 2003 Urban & Fischer. Опубликовано Elsevier GmbH. Все права защищены.

Рекомендуемые статьи

Ссылки на статьи

Frontiers in Plant Science

Frontiers in Plant Science — ведущий журнал в своей области, публикующий тщательно рецензируемые исследования, направленные на углубление нашего понимания фундаментальных процессов в биологии растений.Полевой главный редактор профессор Юнде Чжао из Калифорнийского университета поддерживается выдающимся редакционным советом, состоящим из международных исследователей. Этот междисциплинарный журнал с открытым доступом находится в авангарде распространения и передачи научных знаний и важных открытий исследователям, ученым, политикам и общественности во всем мире.

В постоянно меняющемся мире наука о растениях имеет первостепенное значение для обеспечения будущего благополучия человечества. Растения обеспечивают кислород, продукты питания, корма, волокна и строительные материалы, а также являются разнообразным источником промышленных и фармацевтических химикатов.Кроме того, они имеют центральное значение для здоровья экосистем, а управление и поддержание устойчивой биосферы требуют их глубокого понимания. Базовые знания о процессах биологии растений лежат в основе нашей способности использовать и улучшать растения для устойчивого производства продуктов питания, биотоплива и возобновляемых биоматериалов, а также лучше понимать их роль в окружающей среде.

Наука о растениях чрезвычайно междисциплинарна: от молекулярной генетики сельскохозяйственных культур, клеточной биологии и физиологии до экологии, эволюции и патогенов растений. Он использует последние разработки в области компьютерных наук, оптики, молекулярной биологии, биохимии и геномики для решения проблем на клеточном уровне, внутри целых растений и в экосистемах; он исследует форму, функцию, метаболизм, рост, развитие, разнообразие, размножение, эволюцию и их взаимодействие с окружающей средой и другими организмами во всей биосфере.

Frontiers in Plant Science приветствует оригинальный и значительный вклад из разных областей — от анализа отдельных растений до популяций и всей экосистемы; от молекулярных до биофизических и вычислительных подходов; от молекулярных до исследований в масштабе организма.

Пожалуйста, учитывайте требования к качеству и содержанию экспериментальных исследований, указанные ниже

Количественный анализ необходимо проводить как минимум в 3 биологических повторностях, чтобы можно было оценить значимость. Сюда входят количественные исследования омики (транскриптомика, протеомика, метаболомика), а также фенотипические измерения, количественные анализы и анализ экспрессии КПЦР. Исследования, которые не соответствуют этим требованиям к повторению, не будут рассматриваться для рассмотрения.

Исследования, подпадающие под категории, указанные ниже, не будут рассматриваться для обзора, если они не будут расширены и не дадут представление об изучаемой биологической системе или процессе:

i) Описательная коллекция транскриптов, белков или метаболитов, включая сравнительные наборы, полученные в результате различных условий или лечения;
ii) Описательные исследования, определяющие семейства генов с использованием базовой филогенетики и присвоением беглых функциональных атрибутов (например, профилей экспрессии, уровней гормонов или метаболитов, анализа промоторов, информационных параметров).

Исследования с использованием трансгенных или мутантных линий (растений и водорослей) должны быть основаны на данных о нескольких независимых аллелях (не менее 2), демонстрирующих общий и стабильный фенотип. Примеры включают Т-ДНК, транспозон, РНКи, CRISPR/Cas9, химически индуцированные, гиперэкспрессоры, слияния репортеров (GUS, FP, LUC) и т. д. Качественные данные могут быть представлены для одного аллеля, но должны отражать наблюдения для нескольких аллелей, которые должны быть прямо указано в тексте. Количественные данные должны быть получены из нескольких аллелей (не менее 2) и должны отображаться отдельно для каждого аллеля (не менее 3 независимых повторов для каждого аллеля).Исследования, сообщающие об отдельных аллелях, могут считаться приемлемыми, если:


i) Дополнение через преобразование используется для подтверждения;
ii) Этот аллель был ранее охарактеризован и опубликован и является репрезентативным для нескольких независимых линий;
iii) Системы, в которых генетическая трансформация затруднена или еще невозможна, должны быть представлены альтернативные доказательства, подтверждающие заявленный аллель.


Frontiers in Plant Science  является членом Комитета по этике публикаций.

Кофеин (для подростков) – Nemours KidsHealth

Что такое кофеин?

Кофеин — это наркотик, содержащийся в листьях и семенах многих растений. Его также производят искусственно и добавляют в некоторые продукты и напитки. Кофеин (произносится: ка-ФИН) — это наркотик, потому что он стимулирует центральную нервную систему, вызывая повышенную бдительность. Кофеин дает большинству людей временный заряд энергии и улучшает настроение.

Кофеин содержится в чае, кофе, шоколаде, многих безалкогольных напитках, обезболивающих и других безрецептурных лекарствах и добавках.В своей естественной форме кофеин имеет очень горький вкус. Но большинство напитков с кофеином достаточно обработаны, чтобы скрыть горький вкус.

Подростки получают большую часть кофеина из безалкогольных, кофейных и энергетических напитков. Эффект кофеина может ощущаться до 6 часов.

Что делает кофеин?

Кофеин может помочь вам чувствовать себя бодрым и сосредоточенным. Но это также может вызвать беспокойство, расстройство желудка, головные боли и дрожь. Кофеин может затруднить сон. То, как кто-то реагирует на кофеин, зависит от возраста, веса, пола и чувствительности человека к кофеину.

Чувствительность к кофеину — это количество кофеина, вызывающее симптомы. Это варьируется от человека к человеку. Но люди, которые регулярно употребляют много кофеина, становятся менее чувствительными к нему. Это означает, что им нужно больше кофеина, чтобы получить тот же эффект.

Кофеин повышает частоту сердечных сокращений, кровяное давление и выработку гормонов стресса. Людям с некоторыми заболеваниями следует избегать употребления кофеина. Поговорите со своим врачом о потреблении кофеина, если у вас высокое кровяное давление или проблемы с сердцем, вы принимаете лекарства или добавки, отпускаемые без рецепта, или испытываете стресс или тревогу.

Сколько кофеина можно выпить?

Кофеин безопасен, если вы не употребляете его слишком много. Эксперты рекомендуют подросткам получать не более 100 мг кофеина в день (около 1 чашки кофе или 2 газированных напитков с кофеином).

Но даже небольшое количество кофеина в день может сделать человека зависимым от него. Это означает, что если вы внезапно откажетесь от кофеина, у вас будут симптомы отмены кофеина, такие как головные боли, проблемы с концентрацией внимания, а также чувство усталости и раздражительности.

Как сократить потребление кофеина?

Если вы употребляете слишком много кофеина, возможно, вы захотите сократить его потребление.Чтобы избежать синдрома отмены кофеина, попробуйте сокращать потребление кофеина медленно.

Замените газированные напитки и кофе напитками без кофеина, такими как вода, кофе без кофеина, газированные напитки без кофеина и чай без кофеина.

Следите за тем, сколько напитков с кофеином вы выпиваете каждый день. Затем замените один из этих ежедневных напитков альтернативой без кофеина или без кофеина.

Примерно через неделю замените еще один из ваших ежедневных напитков с кофеином на напиток без кофеина или без кофеина.

Делайте это столько недель, сколько потребуется, чтобы довести ежедневное потребление кофеина до одной порции кофеина в день или даже меньше.

Сократив потребление кофеина, вы можете почувствовать усталость. Обязательно высыпайтесь и заряжайтесь энергией с помощью упражнений. По мере того, как ваше тело приспосабливается к меньшему количеству кофеина, уровень вашей энергии должен вернуться к норме через несколько дней.

Публикации Кей Шитс

Scheets, K. (2016) Анализ функций генов вируса хлоротической крапчатости кукурузы. Virus Research 222, 71-79
http://www.sciencedirect.com/science/article/pii/S0168170216300211

Шитс, К., Джордан, Р., Уайт, К.А., и Эрнандес, К. (2015) Pelarspovirus, предполагаемый новый род в семействе Tombusviridae. Архив вирусологии 160, 2385-2893 [pdf]

Scheets, K. (2013) Инфекционные транскрипты бессимптомного паниковируса, выявленные в результате метагеномного исследования. Virus Research 176, 161-168 http://dx.doi.org/10.1016/j.virusres.2013.06.001

Wangai, A.W., Redinbaugh, M.G., Kinyua, Z.M., Miano, D.W., Leley, P.K., Kasina, M. , Mahuku, G., Scheets, K., and Jeffers, D.(2012) Первое сообщение о вирусе хлоротической крапчатости кукурузы и летальном некрозе кукурузы в Кении. Болезнь растений 96, 1582-1582 [pdf]

Wang, Z., Parisien, M., Scheets, K., and Miller, W. A. ​​(2011) Кэп-связывающий фактор инициации трансляции, eIF4E, связывает псевдоузел в вирусном кэп-независимом элементе трансляции. Структура 19, 868-880 [pdf]

Scheets, K., Blinkova, O., Melcher, U., Palmer, MW, Wiley, GB, Ding, T., and Roe, BA (2011) Обнаружение представителей Tombusviridae в заповеднике Tallgrass Prairie, графство Осейдж , Оклахома, США.Virus Research 160, 256-263 http://dx.doi.org/10.1016/j.virusres.2011.06.023

Рен, Дж. Д., Руссинк, М. Дж., Нельсон, Р. С., Шейтс, К., Палмер, М. В., и Мелчер, У. (2006) Биоразнообразие вирусов растений и экология. PLOS Biology 4, e80 [pdf]

Scheets, K., and Redinbaugh, M.G. (2006) Инфекционные транскрипты кДНК вируса полосатости некроза кукурузы: инфекционность и характеристики трансляции. Вирусология 350, 171-183 [pdf]

Делла Ведова, С. Б., Лорбике, Р., Кирш, Х., Schulte, MB, Scheets, K., Borchert, LM, Scheffler, BE, Wienand, U., Cone, KC, и Birchler, JA (2005) Доминирующий аллель ингибирующей халконсинтазы C2-Idf (ингибитор диффузный) от Zea mays (L.) действует через эндогенный механизм сайленсинга РНК. Генетика 170, 1989-2002 [pdf]

Guenzi, A.C., Scheets, K., Green, J.L., и Fellers, J.P. (2004) Разработка и характеристика неморфогенетической клеточной линии пшеницы (Triticum aestivum). Культура тканей и органов растений 78, 23-28 [pdf]

Шитс, К.(2000)Махломовирус хлоротической крапчатости кукурузы экспрессирует свой белок оболочки из субгеномной РНК размером 1,47 т.п.н. и образует субгеномную РНК размером 0,34 т.п.н. Вирусология 267, 90-101 [pdf]

Scheets, K. (1998) Концентрация хлоротической крапчатой ​​махломовирусной кукурузы и римовирусной полосатой мозаики пшеницы увеличивается при синергическом летальном некрозе кукурузы. Вирусология 242, 28-38 [pdf]

Scheets, K. , Khosravi-Far, R., and Nutter, R.C. (1993) Транскрипты клона кДНК вируса хлоротической крапчатости кукурузы реплицируются в протопластах кукурузы и заражают растения кукурузы.Вирусология 193, 1006-100

Наттер, Р. К., Шейтс, К., Панганибан, Л. К., и Ломмель, С. А. (1989) Полная последовательность нуклеотидов генома вируса хлоротической крапчатости кукурузы. Исследование нуклеиновых кислот 17, 3163-3177

Scheets, K., and Hedgcoth, C. (1989) Экспрессия гамма-глиадина пшеницы в Saccharomyces cerevisiae с дрожжевого промотора Adh2. Журнал сельскохозяйственной и пищевой химии 37, 829-833

ОНЛАЙН-ПУБЛИКАЦИИ, ПРОВЕРЕННЫЕ ICTV

Scheets K (2016) Таксономическое предложение ICTV 2016.006aP.A.v1.Umbravirus_2sp. Создать 2 вида в роде Umbravirus, семействе Tombusviridae. https://talk.ictvonline.org/files/ictv_official_taxonomy_updates_since_the_8th_report/m/plant-official/6674

Scheets K, White KA, Rubino L, Martelli GP, Rochon D’A (2015) Таксономическое предложение ICTV 2015. 007a-rP.A.v1.split_Carmovirus. Разделите род Carmovirus (семейство Tombusviridae) на три новых рода: Alphacarmovirus, Betacarmovirus и Gammacarmovirus. https://talk.ictvonline.org/files/ictv_official_taxonomy_updates_since_the_8th_report/m/plant-official/5841

Scheets K, Rochon D’A (2015) Таксономическое предложение ICTV 2015.008aP.A.v1.Aureusvirus_sp. Создать вид шаровидного вируса ямса в роде Aureusvirus, семействе Tombusviridae. https://talk.ictvonline.org/files/ictv_official_taxonomy_updates_since_the_8th_report/m/plant-official/1117

Scheets, K., Jordan, R., White, A. and Hernandez, C., (2015) Таксономическое предложение ICTV 2014.006b-fPA..v3.Pelarspovirus. В семействе Tombusviridae относят 5 ранее не отнесенных видов к новому роду, Pelarspovirus.
https://talk.ictvonline.org/files/ictv_official_taxonomy_updates_since_the_8th_report/m/plant-official/5847

Шитс, К., Уайт К.А., Рубино Л., Мартелли Г. и Рочон Д.А. (2015) Таксономическое предложение ICTV 2015.007a-rP.A.v1.split_Carmovirus. Разделите род Carmovirus (семейство Tombusviridae) на три новых рода: Alphacarmovirus, Betacarmovirus и Gammacarmovirus. https://talk.ictvonline.org/files/ictv_official_taxonomy_updates_since_the_8th_report/m/plant-official/5841

Рошон Д. А., Шитс К., Уайт А., Мартелли Г. и Рубино Л. (2014) Таксономическое предложение ICTV 2013.010a,bP.A.v2.Umbravirus_move.Переместите род Umbravirus в семейство Tombusviridae. https://talk.ictvonline.org/files/ictv_official_taxonomy_updates_since_the_8th_report/m/plant-official/5124

Scheets, K. (2014) Таксономическое предложение ICTV 2014.007aP.A.v1.Panicovirus_sp. Создать 1 новый вид в роде Panicovirus, семействе Tombusviridae. https://talk.ictvonline.org/files/ictv_official_taxonomy_updates_since_the_8th_report/m/plant-official/5201

Scheets, K., Hernandez, C., Jordan, R., and White, A. (2014) Таксономическое предложение ICTV 2014.006aP.A.v2.Tombusviridae_4sp. Создать 4 новых вида, не относящихся к семейству Tombusviridae. https://talk.ictvonline.org/files/ictv_official_taxonomy_updates_since_the_8th_report/m/plant-official/5209

Scheets, K., and Melcher, U. (2014) Таксономическое предложение ICTV 2014.008aP.A.v3.Tombusviridae_sp. Создать 1 новый вид, не назначенный в семействе Tombusviridae. https://talk.ictvonline.org/files/ictv_official_taxonomy_updates_since_the_8th_report/m/plant-official/5134

ПРИГЛАШЕННЫЕ ГЛАВЫ КНИГИ

Шитс, К.(2012)Вирус хлоротической крапчатости кукурузы. В «Справочнике по защите растений». Уоллингфорд, Великобритания, CAB International. www.cabi.org/cpc [для доступа к таблицам данных требуется авторизация]

Scheets, K. (2011) Махломовирус (Tombusviridae), 2-е изд. В «Индексе вирусов Спрингера» (К. Тидона и Г. Дараи, ред.), стр. 1901–1905. Springer-Verlag, Берлин Гейдельберг Нью-Йорк Токио

Scheets, K. (2009) Махломовирус. 1-е изд. В «Настольной энциклопедии вирусологии растений и грибов» (B. Mahy и M. van Regenmortel, Eds.), стр. 204-208. Эльзевир, Оксфорд, Сан-Диего

Scheets, K. (2008) Махломовирус. 3-е изд. В «Энциклопедии вирусологии» (Б. Махи и М. ван Регенмортель, ред.), стр. 259–263. 5 тт. Эльзевир, Оксфорд

Scheets, K. (2004) Летальный некроз кукурузы. В “Вирусы и вирусные заболевания Poaceae (Gramineae)” (H. Lapierre и P. Signoret, ред.), стр. 622-623. ИНРА, Париж

Scheets, K. (2004) Род Machlomovirus. В «Вирусы и вирусные заболевания Poaceae (Gramineae)» (H. Lapierre и P.Синьоре, ред.), стр. 410-411. ИНРА, Париж

Scheets, K. (2004) Вирус хлоротической крапчатости кукурузы. В “Вирусы и вирусные заболевания Poaceae (Gramineae)” (H. Lapierre и P. Signoret, ред.), стр. 642-644. ИНРА, Париж

Наедине с природой: более 160 слов о природе на английском языке

Вы когда-нибудь мечтали о большом саду, полном фруктов, овощей и цветов?

Чтобы вырастить собственный сад, вам нужно будет посадить несколько семян, регулярно поливать и заботиться о маленьких ростках (маленьких растениях), пока они не вырастут в съедобные (то, что вы можете есть) и декоративные (что-то красивое) взрослые растения.

Посадка и уход за садом очень похожи на пополнение словарного запаса !

Во-первых, вам нужно найти новые слова из словарных списков; это этап «посадки семян».

Далее вам нужно выучить значения слов в вашем списке; это этап «полива».

Кроме того, вам потребуются забавные упражнения для расширения словарного запаса. Думайте об этом как о шаге «прорастания», когда ваш словарный запас начинает действительно расти.

Со временем ваш словарный запас английского языка обязательно пополнится, если вы позаботитесь о нем!

Семена, которые мы собираемся посадить сегодня, связаны с словами о природе на английском языке .

Многие слова природы в этом списке больше подходят для изучающих английский язык от среднего до продвинутого уровня , , но есть много слов, которые могут выучить и новички, изучающие английский язык, !

Так как в этом списке более 160 слов , независимо от вашего языкового уровня, вы обязательно подберете красивый словарный запас природы!

Скачать: Этот пост в блоге доступен в виде удобного переносимого PDF-файла, который вы можно взять куда угодно.Нажмите здесь, чтобы получить копию. (Скачать)

Лучший способ практиковать слова природы на английском языке

Долговременная память — это место, где знания и словарные слова сохраняются в течение длительного времени. Это означает, что как только слово окажется в вашей долговременной памяти, вы сможете использовать его через неделю, через месяц или даже через год.

Хотя запоминание списков слов может быть быстрым способом изучения словарного запаса природы, простое запоминание не часто приводит к долговременной памяти .

Чтобы переместить слова из краткосрочной памяти в долговременную, вы должны сделать слова значимыми для вас .

При изучении нового слова попробуйте использовать его в полном предложении и запишите это предложение в блокнот.

Во многих случаях вы можете использовать несколько слов, связанных друг с другом, чтобы помочь вам запомнить их значение.

Например:

Кора  на ветке сосны грубая.

Чтобы продвинуться в своей практике, попробуйте отправиться на прогулку на природу. Пока вы идете, создавайте предложения и описания того, что вы видите.

Например:

  кусты  и пещера  у водопада .

А еще лучше запишите эти предложения или возьмите с собой диктофон! Это отличный способ использовать слова природы и записывать описания, которые вы создаете, чтобы просмотреть их позже.

Теперь, когда вы готовы посадить и вырастить свой словарный сад английского языка, давайте рассмотрим более 160 самых популярных слов о природе на английском языке.

Описание природы

Помимо настоящих названий растений и ландшафтов, важно уметь точно описывать эти существительные (люди, места или вещи).

Описание природы не только углубляет ваше понимание и запоминание этих слов природы, но также позволяет вам нарисовать картину для слушателя, если вы забыли конкретное слово природы.

Например, если вы забыли слово цветок на английском языке, вы можете использовать его описание, чтобы помочь кому-то понять вас.

Они прекрасны, когда цветут, а летом растут в саду.

Очевидно, вы могли бы использовать цвет для описания слов природы, но, поскольку вы, вероятно, уже знаете английские слова, обозначающие цвета, мы будем использовать ваше время более разумно.

Описание цветов, растений и деревьев

Выучите следующие 17 прилагательных (слов, описывающих существительные) и их значения, чтобы с легкостью описывать цветы, растения и деревья.

Lush — растения и цветы, которые хорошо выросли

Травяной — используется для описания лугов и полей с большим количеством травы или зеленых растений

Цветочный  — используется для описания садов или ландшафтов с большим количеством цветов

Vivid  — что-то яркое или красочное

Abloom  — используется для описания цветов или групп цветов, которые цветут

Яркий  — что-то яркое и привлекающее внимание

Плотный  — используется для описания растений, которые растут близко друг к другу и через которые трудно увидеть, потому что они очень толстые

Земляной  — что-то, что содержит или выглядит как почва или грязь

Разнообразный — используется для описания сада или ландшафта с большим количеством различных растений

Скудный — используется для описания ландшафта с очень небольшим количеством растений

Сухой  — без воды

Без растений — без растений

Мертвый — используется для описания растений, которые больше не живут

Перенасыщение — используется для описания растений, подвергшихся воздействию слишком большого количества воды или дождя

Затопленный — используется для описания ландшафтов, покрытых водой из-за разлива рек или озер

Цветение — используется для описания того, когда на растениях впервые появляются цветы

Бутонизация — используется для описания первой стадии цветения

Описание ландшафтов и геологических особенностей

Следующие 12 прилагательных можно использовать для описания ландшафтов и геологических объектов (вещей, встречающихся в природе, которые не являются растениями или животными).

Холмистый — ландшафт с множеством холмов

Горный  ландшафт с большим количеством гор

Волнистый используется для описания воды с бурной водой

Катящийся  используется для описания ландшафта с множеством холмов, который напоминает (выглядит) океанские волны

Буря  описывающие сильный дождь, молнии, гром и ветер

Туманный  ландшафт с легкой дымкой дождя в воздухе; океаны и водопады часто производят туман

Холодный экстремально холодный

Пустыня  голый ландшафт, где мало растений

Нетронутый ландшафт, не измененный человеком

Нетронутый пышный пейзаж, который кажется нетронутым или «идеальным как на картинке»

Тропический —  теплый пейзаж с растениями джунглей и пальмами; распространен на островах у экватора

Засушливый  —  сухой ландшафт, на который выпадает очень мало осадков

Описание погодных условий

Следующие 18 прилагательных можно использовать для описания погодных условий на английском языке.

Солнечно много солнца

Влажный много влаги в воздухе

Душно так жарко, что некомфортно

Мрачно пасмурная и серая погода

Дождь сильный непрерывный (продолжающийся) дождь

Сухой Небольшой дождь или его отсутствие

Облачно небо в основном покрыто облаками

Туман —  используется для описания ландшафта с большим количеством тумана (легкое облако на уровне земли)

Ясно Без облаков и дождя

Хрустящие описывающие холодную температуру

Прохладный  слегка холодный или прохладный

Ветрено —  сильный ветер

Ветер  то же значение, что и ветрено , но ветер менее сильный, чем ветер

Мокро пейзаж после сильного дождя

Ясная Погода ясная и теплая

Мягкий приятный или не слишком теплый

Неподвижный Без ветра

Пасмурно  на небе много облаков, но дождя мало или совсем нет

Разговор о видах растений и частях растений

Теперь, когда мы научились описывать природу, давайте узнаем о вещах, которые мы можем найти в природе, и о том, как рассказать о них больше!

Маленькие и тонкие растения

Кустарник  растение, растущее близко к земле; он широко разрастается и имеет листья

Кустарник  другое слово для куст

Живая изгородь похожа на куст , но часто подстрижена под прямоугольник; они часто окружают дома или используются для создания границы или забора

Трава  растение, широко растущее на полях и лугах; также часто встречается на приусадебных газонах

Мох  мягкое растение, растущее на камнях и деревьях; похоже на зеленый ковер

Гриб  гриб, растущий в темных местах; некоторые можно есть, а другие ядовиты

Трава  различное растение, используемое для ароматизации пищи (базилик, кинза, мята, и т. д. .) или в качестве лекарства или чая

Папоротник древнее (очень старое) растение, листья которого похожи на перья

Тростник  растение, похожее на высокую траву и растущее на болотах и ​​болотах

Бамбук  растение, похожее на длинные стебли дерева и произрастающее в тропических местах

Плющ  растение с пятиконечными листьями, которое растет близко к земле и лазает по деревьям и зданиям

Ядовитый плющ вид плюща, вызывающий сильный зуд и сыпь при прикосновении

Основные части установок

Семя — из чего вырастают растения

Корень часть растения, которая остается под землей и поглощает воду

Стебель часть растения, которая растет вверх и держит цветок

Стержень — другое слово для стержня

Лист — зеленая часть растения, поглощающая солнечный свет

Лепесток разноцветные части цветка

Бутон — первая стадия роста растения, которое будет цвести и цвести

Шип часть стебля цветка или растения колючая и острая

Ветка часть дерева, вырастающая из ствола

Веточка Маленькая ветка

Кора внешняя оболочка дерева

Красивые и обычные цветы

Нарцисс  цветок с маленькими желтыми лепестками

Роза цветки с шипами и ярко-красными лепестками; это связано с романтикой и любовью

Одуванчик сорняк с желтыми цветками

Маргаритка  цветок с белыми лепестками вокруг желтой верхушки

Лилия  цветок среднего размера, лепестки которого могут быть разных цветов

Тюльпан распространен во многих садах и известен в Голландии; они могут быть разных цветов и связаны с Пасхой

Подсолнух большой цветок с ярко-желтыми лепестками и коричневой верхушкой

Теперь, когда вы знаете все основы, попробуйте попрактиковаться в словарном запасе растений!

Типичные высокие деревья

Два распространенных типа деревьев:  лиственные  и  вечнозеленые .

Лиственные деревья сбрасывают листву в определенное время года (обычно осенью/осенью), а вечнозеленые деревья сохраняют листву весь год.

Однако не все деревья попадают в эти две категории, как вы увидите в этом коротком списке. На нашей планете насчитывается более 60 000 видов деревьев!

Пальма (ни листопадная, ни вечнозеленая) тропическое дерево с пальмами и иногда кокосами (большие перистые листья)

Кактус (ни листопадный, ни вечнозеленый) растет в пустыне с шипами или чертополохом (заостренными, острыми шипами)

Клен лиственное дерево с трехконечными листьями

Дуб — лиственное дерево с желудями

Береза ​​ — лиственное дерево с тонкой белой корой

Ива  большое листопадное дерево с тонкими листьями и ветвями, похожими на куртины

Тополь лиственное дерево среднего размера с каплевидными листьями

Сосна вечнозеленое дерево с игольчатыми листьями и сосновыми шишками

Садовые инструменты для ухода за растениями

Если вы хотите позаботиться о своих растениях, вам понадобятся садовые инструменты.

Садовник Тот, кто ухаживает за садом

Цветочный горшок  контейнер, в котором растут один или несколько цветов

Огород  огород, специально предназначенный для выращивания овощей

Сорняк Нежелательное растение в саду

Сорняк —  (глагол действия) вырвать и удалить сорняки из сада

Лопата инструмент для копания земли

Ведро цилиндрическая (круглая) емкость для переноски воды

Лейка  контейнер, специально предназначенный для полива растений

Ножницы  инструмент, используемый для обрезки или обрезки растений

Грабли  инструмент для сбора срезанных растений или опавших листьев с земли

Мотыга Однолезвийный инструмент для выкапывания сорняков

Сеять —  (глагол действия) посадить семена

Косить (глагол действия) подстригать траву, часто с помощью газонокосилки

Газонокосилка  машина для скашивания газона; он может быть газовым или ручным

Тачка Одноколесная тележка для перевозки садовых материалов

Сарай небольшой навес во дворе, в котором хранятся садовые материалы или другие предметы и инструменты на открытом воздухе

Красивые пейзажи

На нашей планете так много красивых пейзажей!

Залив где море изгибается внутрь, образуя водоем с берегами с трех сторон

Озеро   небольшой водоем внутри страны; озера часто пресноводные

Море большой водоем с соленой водой; на самом деле в мире около 50 морей

Океан  большой водоем с соленой водой; есть пять океанов: Атлантический, Тихий, Индийский, Северный Ледовитый и Южный

Река текущая вода

Крик тонкая река

Водопад  когда вода падает с более высокой точки (например, со скалы) на более низкую точку

Каньон засушливая и каменистая долина, окруженная скалами

Ледник  большое ледяное пространство вокруг полярных регионов Земли

Луг большое поле с травами и цветами

Лес  ландшафт с густой растительностью и деревьями

Гора  большая возвышенность на Земле; горы часто скалистые, покрытые снегом или вулканические

Холм   небольшое возвышение на Земле

Равнина  плоский участок земли; равнины часто покрыты травой

Болото  участок земли, регулярно затопляемый и остающийся водонасыщенным

Остров   пространство суши, со всех сторон окруженное водой

Полуостров  участок суши, окруженный водой с трех сторон

Саванна засушливое поле в тропическом регионе; в африке много

Долина  участок земли между горами или холмами

Пустыня   сухой ландшафт, часто покрытый песком или камнями; здесь растет не так много растений

Тундра сухой ландшафт в холодном климате

Утёс  отвесное горообразное образование; они распространены вдоль побережья

Пещера туннель или камера под землей

Пляж песчаный участок земли у водоемов

Поле  пространство земли, на котором распространены травы и другие растения

Не забывайте практиковать свой ландшафтный словарный запас!

Древние геологические особенности

Слово геология  это существительное, означающее изучение Земли и ее физических процессов.

В этом списке лексики также есть слова, описывающие важные события, влияющие на деятельность человека и вызванные Землей.

Коренная порода большие пространства плоских скал

Осадочная порода горная порода, перемещаемая водой или ветром

Изверженная порода горная порода, полученная непосредственно из лавы или магмы

Метаморфическая горная порода осадочные или изверженные породы, измененные экстремально высокой температурой

Кратер большое круглое отверстие или углубление в Земле; обычно образуется вулканом

Эрозия   когда вода или воздух отрываются от породы

Ископаемые старые останки растений или животных, которые давно умерли

Драгоценный камень драгоценный камень, часто используемый в ювелирных изделиях

Гейзер когда из-под земли брызжет горячая вода

Горячий источник бассейн, в котором вода нагревается подземными земными процессами

Минерал  твердый материал, созданный Землей

Сейсмическая активность движение земных плит, создаваемое естественными процессами

Землетрясение  сдвиг сейсмических плит, вызывающий сотрясение и раскол Земли

Вулкан гора, образованная извержениями и лавой

Магма горячая жидкость под Землей

Лава  когда магма выходит из-под земли

Извержение при извержении лавы или магмы из Земли на вершине вулкана

Цунами гигантская волна, часто вызываемая подводным землетрясением

Ископаемое топливо   природное топливо, сжигаемое людьми для запуска таких вещей, как автомобили, самолеты и электричество

Словарь по изменению климата

Изменение климата  это существительное, описывающее глобальные погодные условия и температуры, которые изменились из-за воздействия человеческой деятельности.

Атмосфера слои газов в небе, окружающие Землю

Озон  —  кислородный слой над Землей, защищающий нас от солнца

Углекислый газ то, что мы выдыхаем, когда дышим; мы также создаем это, сжигая ископаемое топливо

Выбросы они образуются при сжигании ископаемого топлива; они обычно выходят из автомобилей, электростанций и заводов

Экосистемы  сообщество растений и животных, выживание которых зависит друг от друга

Среда обитания место, где живет животное

Вымирание  когда все представители вида животных умирают

Парниковый эффект когда выбросы застревают под земной атмосферой и нагревают планету

Загрязнитель то, что загрязняет или наносит ущерб Земле

Невозобновляемый ресурс ресурс, который можно использовать только один раз; например природный газ

Возобновляемый ресурс  ресурс, который можно использовать снова и снова; например ветер

Уголь древняя растительная материя теперь в форме камня, которую можно сжигать в качестве топлива

Нефть  находящаяся в Земле жидкость, которую можно сжигать в качестве топлива

Солнечная энергия форма энергии, использующая солнечные лучи

Энергия ветра форма энергии, использующая ветер

Засуха когда ландшафт сухой в течение длительного периода времени

Ледяные шапки  другое название ледников в полярных регионах Земли

Хотя некоторые из этих слов довольно сложны, использование словарного запаса, связанного с изменением климата, важно, если вы хотите рассказать о текущих событиях, связанных с окружающей средой.

А если вы готовы к серьезному испытанию, попробуйте потренировать все слова природы вместе!

 

Вау!

Ваш словарный запас английских природных слов превратился в прекрасный сад!

Позаботьтесь о семенах, которые вы только что посадили, и наблюдайте, как растет ваш словарный запас природы!

Скачать: Этот пост в блоге доступен в виде удобного переносимого PDF-файла, который вы можно взять куда угодно. Нажмите здесь, чтобы получить копию.(Скачать)

.