Аквапорины вид транспорта: Facilitated Transport | Protocol (Translated to Russian)

Содержание

Facilitated Transport | Protocol (Translated to Russian)

5.10: Пассивный транспорт

Химические и физические свойства плазматических мембран делают их избирательно проницаемыми. Поскольку плазматические мембраны имеют как гидрофобные, так и гидрофильные области, вещества должны иметь возможность пересекать обе области. Гидрофобная область мембран отталкивает такие вещества, как заряженные ионы. Следовательно, таким веществам необходимы особые мембранные белки для успешного прохождения через мембрану. В процессе облегченного транспорта, также известного как облегченная диффузия, молекулы и ионы перемещаются через мембрану через два типа мембранных транспортных белков: каналы и белки-переносчики. Эти мембранные транспортные белки обеспечивают диффузию, не требуя дополнительной энергии.

Канальные белки

Канальные белки образуют гидрофильные поры, через которые могут проходить заряженные молекулы, избегая, таким образом, гидрофобного слоя мембраны.

Канальные белки специфичны для данного вещества. Например, аквапорины представляют собой канальные белки, которые специально способствуют транспортировке воды через плазматическую мембрану.

Канальные белки либо всегда открыты, либо закрыты каким-то механизмом для управления потоком. Закрытые каналы остаются закрытыми до тех пор, пока определенный ион или вещество не свяжется с каналом, или пока не сработает какой-либо другой механизм. Закрытые каналы находятся в мембранах таких клеток, как мышечные и нервные клетки. Мышечные сокращения происходят, когда относительные концентрации ионов на внутренней и внешней сторонах мембраны изменяются из-за контролируемого закрытия или открытия ворот канала. Без регулируемого барьера сокращение мышц не будет происходить эффективно.

Белки-носители

Белки-носители связываются с определенным веществом, вызывая конформационное изменение белка. Конформационное изменение позволяет двигаться вниз по градиенту концентрации вещества.

По этой причине скорость транспорта зависит не от градиента концентрации, а от количества доступных белков-носителей. Хотя известно, что белки меняют форму, когда их водородные связи дестабилизированы, полный механизм, с помощью которого белки-носители изменяют свою конформацию, не совсем понятен.

Скорость диффузии

Несмотря на то, что более сложный, чем простая диффузия, облегченный перенос позволяет диффузии происходить с невероятной скоростью. Канальные белки перемещают десятки миллионов молекул в секунду, а белки-носители перемещают от тысячи до миллиона молекул в секунду.


Литература для дополнительного чтения

Isacoff, Ehud Y., Lily Y. Jan, and Daniel L. Minor. “Conduits of Life’s Spark: A Perspective on Ion Channel Research since the Birth of Neuron.” Neuron 80, no. 3 (October 30, 2013). [Source]

Нобелевский лауреат Питер Эгр выступил в Москве с лекцией и рассказал про водный транспорт внутри человека

О том, как внутри человека происходит движение воды и как его регуляция влияет на здоровье, корреспондент «Газеты. Ru» рассказывает, побывав в МГУ на лекции нобелевского лауреата Питера Эгра, врача и молекулярного биолога, президента Американской ассоциации развития науки (AAAS).

Нобелевскую премию по химии в 2003 году Питер Эгр получил за открытие аквапорина. Как, собственно, следует из его названия, аквапорин образует поры для воды — водные каналы в мембране клетки. Вода составляет 70% нашей массы, подчеркнул ученый, вода – это жизнь. Но она не распределена в организме равномерно, вода движется в разных направлениях и на своем пути пересекает барьеры клеточной мембраны.

Довольно давно исследователям стало ясно, что вода не может преодолевать клеточную мембрану только путем диффузии. Это очень медленный способ передвижения, и, вероятно, для быстрого транспорта воды существуют специальные мембранные каналы. «Но молекулы, составляющие эти каналы, долгое время не удавалось выделить, — рассказывает Питер Эгр. — Только благодаря счастливому случаю нам удалось это сделать». Ученые открыли сначала один белок – аквапорин-1 (AQP-1), образующий трансмембранный канал для активного транспорта воды.

«Здесь проходит вода, и только вода», — подчеркнул Питер Эгр. То, что водные поры непроницаемы для ионов — заряженных частиц, позволяет сохранять электрохимический мембранный потенциал.

Методом рентгеновской кристаллографии исследователи определили структуру молекулы аквапорина-1. Это молекула-тетрамер, состоящий из четырех мономеров с трансмембранными участками.

Вслед за первой молекулой были открыты другие белки семейства аквапоринов: AQP-2, AQP-3, AQP-4 и т. д., сейчас у млекопитающих описано 13 аквапоринов, и предполагается, что это еще не все. Найдены и клонированы гены аквапоринов. А затем началось самое интересное — выяснение их физиологической роли в организме.

Прежде всего локализацию аквапорина изучили в почках, так как в функциональной единице почки — нефроне — фильтруется кровь, образуя мочу, а затем путем обратного всасывания воды моча концентрируется.

В почках работают шесть разных аквапоринов. Мутация одного из них приводит к заболеванию — несахарному диабету. У таких больных моча в почках не концентрируется, в результате их организм выводит очень много жидкости, обезвоживается, и они постоянно испытывают жажду.

Аквапорин-4 присутствует в клетках роговицы глаза и клетках мозга. Аквапорин-5 — в клетках секреторных желез, производящих слезы, пот, слюну. Аквапорин-3 работает в клетках эпителия и защищает кожу от обезвоживания, в связи с чем его работой заинтересовались производители косметических кремов. Он же работает в эритроцитах. Питер Эгр, который одно время возглавлял Институт изучения малярии Джонса Хопкинса, и его коллеги большое внимание уделяли роли аквапоринов в эритроцитах и в мозге при заболевании малярией, когда эритроциты лопаются, а мозг раздувается от отека.

Аквапорины-7 и -9, относящиеся к классу глицероаквапоринов, присутствуют в клетках жировой ткани, они участвуют в обмене жиров и активируются при голодании. Анвапорин 9 работает в печени, где он принимает участие в детоксикации.

Аквапорины вездесущи, есть они и у насекомых, и у бактерий, и у растений, которым абсолютно необходимы, так как растения зависимы от наличия воды и не могут перемещаться в ее поисках.

Что же касается их значения для клинической медицины, то Питер Эгр перечислил группы совершенно разных заболеваний, природа которых связана с аквапоринами: болезни почек, нарушения зрения, повреждения и отеки мозга, ожирение, гипертермия, малярия, интоксикация.

А есть ли сегодня лекарственные препараты, для которых аквапорины служат мишенью?

Отвечая на вопрос корреспондента «Газеты. Ru», Питер Эгр подчеркнул, что аквапорины — это мишени для фармакологических препаратов будущего. Однако сегодня есть лекарства, которые действуют на вазопрессин и глюкокортикоиды – гормоны, регулирующие уровень аквапоринов.

«Наука сближает людей», — подчеркнул Питер Эгр, рассказав, что в России впервые побывал 47 лет назад еще студентом и получил незабываемые впечатления от людей и русской души. «Всегда относитесь к научной деятельности как к приключению, и тогда вы сможете получать от нее настоящее удовольствие», — его пожелание студентам и молодым ученым.

Значение транспорта кислорода через аквапорины – научные доклады

Предметы

  • Мембранная биофизика
  • Физиология растений

Аннотация

Аквапорины – это мембранные интегральные белки, ответственные за трансмембранный транспорт воды и других небольших нейтральных молекул. Несмотря на их общепризнанное значение в водном транспорте, их значение в процессах транспортировки газа остается неясным. Все больше свидетельств указывает на участие растительных аквапоринов в доставке СО 2 для фотосинтеза. Роль этих канальных белков в транспорте O 2 и других газов также может быть более важной, чем предполагалось ранее. В этом исследовании мы исследовали проницаемость O 2 для различных человеческих, растительных и грибковых аквапоринов путем совместной экспрессии гетерологичного аквапорина и миоглобина в дрожжах. Два наиболее перспективных O 2 -транспортера ( Homo sapiens AQP1 и Nicotiana tabacum PIP1; 3) были подтверждены для облегчения транспорта O 2 в спектрофотометрическом анализе с использованием дрожжевых протопластов. Сверхэкспрессия NtPIP1; 3 у дрожжей значительно увеличила скорость поглощения O

2 в суспензионной культуре. В корнях N. tabacum, подвергнутых гипоксической гидропонной среде, уровни транскрипции O 2 -транспортирующего аквапорина NtPIP1; 3 значительно повысились после семидневной обработки гипоксией, что сопровождалось повышением уровней АТФ в сегментах апикального корня. Наши результаты показывают, что функциональное значение аквапорин-опосредованного транспорта O 2 и возможность контроля скорости трансмембранного транспорта O 2 должны быть дополнительно изучены.

Вступление

С тех пор, как были обнаружены, что мембранные внутренние белки (MIP) участвуют в трансмембранном транспорте воды 1, 2, появляются все новые свидетельства того, что различные члены семейства аквапоринов связывают процессы переноса других небольших нейтральных молекул, включая CO

23, 4, 5 . Транспорт этих молекул был связан с фундаментальными физиологическими процессами 3, 6 . Подобно давно преобладающим представлениям о переносе воды, возможное значение опосредованного порами переноса для CO 2 и O 2 иногда преуменьшалось из-за теоретических и экспериментальных данных, свидетельствующих о быстрой диффузии этих газов через липидный бислой 7, 8 . Хотя функциональное значение аквапорин-опосредованного транспорта CO 2 было продемонстрировано для процессов фотосинтеза и клеточной сигнализации 3, 6, важность поро-опосредованного транспорта O 2 для трансцеллюлярных потоков O 2 и функции клеток остается неясной 9, 10, 11 .

В настоящем исследовании мы использовали систему дрожжевых клеток ( Saccharomyces cerevisiae INVSc1, Invitrogen) для совместной экспрессии миоглобина 12 кашалотов ( Physeter macrocephalus ) в дрожжевом экспрессирующем векторе pAG425GAL-ccdB вместе с одним из 20 различных аквапоринов из растений человека. или грибки (Дополнительные информационные примечания S1 и S2) в векторе pAG426GAL-ccdB, чтобы оценить влияние экспрессии гетерологичного аквапорина на оксигенацию миоглобина в качестве показателя проницаемости для O 2 плазматической мембраны дрожжей. Мы также исследовали количество транскриптов собственных белков плазматической мембраны (PIP) в отношении уровней АТФ в корнях Nicotiana tabacum при гипоксии в гидропонной культуре, чтобы оценить возможную функциональную значимость O 2 -транспортирующих аквапоринов.

Результаты

Экспрессия белка и содержание транскрипта миоглобина и аквапоринов

Иммуноблоттинг с антителом против миоглобина продемонстрировал присутствие миоглобина в отобранных штаммах дрожжей, которые были сконструированы для экспрессии миоглобина, но не в INVSc1 (рис. 1А). Количественная ОТ-ПЦР показала, что содержание транскрипта миоглобина было сходным в трансформированных штаммах дрожжей (рис. S1). Иммуноблоттинг с антителом против человеческого аквапорина 1 продемонстрировал, что антитело распознало экспрессированные гетерологичные аквапорины Homo sapiens HsAQP1, Nicotiana tabacum NtPIP1; 3 и Arabidopsis thaliana AtPIP1; 2 в соответствующих штаммах, а также, слабо, дрожжевые гомологичные аквапорины в насмешке. штамм, сконструированный для экспрессии только миоглобина (Fig. 1B). Анализ qRT-PCR с более высокой специфичностью, чем иммуноблоттинг, показал, что количество транскриптов гетерологически экспрессируемых генов аквапоринов HsAQP1, NtPIP1 ; 3 и AtPIP1 ; 2 было незначительным в фиктивной деформации, но значительно выше в каждой соответствующей деформации (рис. S1).

( A ) Общие белки дрожжей иммуноблотировали с первичным антителом против миоглобина. ( B ) Общие белки дрожжей иммуноблотировали с первичным антителом против аквапорина 1 человека.

Изображение в полном размере

После фиксации формальдегида 13, встраивания парафина и приготовления срезов дрожжевых клеток для иммунодетекции с антителом против человеческого аквапорина 1 была обнаружена сильная иммунофлуоресценция на периферии среза дрожжевых клеток штамма HsAQP1 по сравнению с относительно слабым внутриклеточным сигналом флуоресценции ( Рис. 2), указывающий на плазматическую мембрану как вероятный сайт локализации. Это согласуется с предсказанием субклеточной локализации TargetP 14, что свидетельствует об отсутствии митохондриального нацеливающего пептида и указывает на секреторный путь как наиболее вероятное местоположение HsAQP1 в эукариотических клетках (Таблица дополнительной информации S1).

( A ) HsAQP1 штамм при возбуждении синим светом. ( B ) HsAQP1 штамм в светлом поле. ( C ) Макет деформации при возбуждении синим светом. ( D ) Макет деформации в светлом поле. Длина стержней составляет 10 мкм.

Изображение в полном размере

O

2 транспорт

Из исследованных штаммов дрожжей штаммы, экспрессирующие HsAQP1, NtPIP1; 3, NtPIP1; 4, NtPIP2; 1 и NtXIP1; 1, показали статистически значимое увеличение проницаемости O 2 с предварительными спектрофотометрическими измерениями, о чем свидетельствуют более высокие скорости изменения миоглобина A 541 оптическая плотность (фиг. S2 и S3A) по сравнению с контрольным показателем (фиг. S3B). Сверхэкспрессия A. thaliana (AtPIP1; 1, AtPIP1; 2, AtPIP1; 3, AtPIP1; 4 и AtPIP2; 1) и Laccaria bicolor (LbAQP1, LbAQP3, LbAQP5, LbAQP6 и LbAQP7 al) не делали. Поглощение 541 (рис. S3B), указывающее на отсутствие значительного влияния на проницаемость O 2 .

Два наиболее перспективных O 2 -транспортера (HsAPQ1 и NtPIP1; 3) и один, который не проявлял O 2 -транспортные свойства в предварительных экспериментах (AtPIP1; 2), а также фиктивный штамм были дополнительно проанализированы в анализе протопластов дрожжей. На основании сканирования спектра очищенного миоглобина (рис. S2) и протопластов дрожжей (рис. S4) были выбраны ∆A 541 / ∆A 600 и ∆A 319 / ∆A 341 (фиг. S5), чтобы указать оксигенацию миоглобина. ∆A 541 / ∆A 600 через 90 с продемонстрировали одинаковую тенденцию по всем штаммам с предварительным анализом: штамм, экспрессирующий NtPIP1; 3, имел самое высокое значение, за которым следовали HsAQP1, mock и AtPIP1; 2 по порядку (рис. 3). ∆A 319 / ∆A 341 через 5 минут с 5-кратной 30-секундной аэрацией продемонстрировали более отчетливую статистическую разницу между HsAQP1 и имитацией, а также между всеми миоглобин-экспрессирующими штаммами и нетрансформированным штаммом INVSc1 (рис. 4).

Звездочки указывают на статистически значимое различие с фиктивной деформацией (значения P показаны в таблице ниже) (ANOVA, тест Тьюки, P ≤ 0, 05, n = 19 ± SE).

Изображение в полном размере

Звездочки указывают на статистически значимое различие с фиктивной деформацией (значения P показаны в таблице ниже) (ANOVA, тест Тьюки, P ≤ 0, 05, n = 6 ± SE).

Изображение в полном размере

Поскольку превращение дезоксимиоглобина в оксимиоглобин зависит от железа и может зависеть от окислительно-восстановительного статуса клеток, окислительно-восстановительное состояние отдельных штаммов после предварительной обработки для анализа транспорта O 2 измеряли с использованием CM-H 2 DCFDA. Интенсивность флуоресценции, генерируемая CM-H 2 DCFDA, не показала существенных различий между штаммами дрожжей после предварительной обработки транспорта O 2 (рис. S6). Это указывает на то, что окислительно-восстановительное состояние клеток в имитационных штаммах HsAQP1, NtPIP1; 3 и AtPIP1; 2 было сходным до анализа транспорта O 2 . Как и в предыдущем сообщении 6, повышенная проницаемость H 2 O 2 была обнаружена в штамме NtPIP1; 2 (рис. S7). Тем не менее, никакого увеличения проницаемости для H 2 O 2 не было измерено в NtPIP1; 3, HsAQP1 или фиктивных штаммах, в то время как немного более высокая интенсивность флуоресценции, свидетельствующая об увеличении проницаемости для H 2 O 2 в AtPIP1; 2, не была статистически значимой (рис. S7).

Потребление дрожжей O

2

Клетки дрожжей, гетерологически экспрессирующие NtPIP1; 3 и HsAQP1, показали 2, 3-кратную и 1, 8-кратную более высокую скорость поглощения O 2, соответственно, по сравнению с фиктивным контролем (фиг. 5A) и истощенным содержанием кислорода из раствора значительно быстрее ( P ≤ 0, 05) (фиг. 5B). и S8). Скорость поглощения O 2 дрожжевыми клетками, экспрессирующими AtPIP1; 2, и время истощения O 2 из раствора незначительно ( P ≥ 0, 05) отличались от контрольных образцов (рис. 5). Диаметр дрожжевых клеток не подвергался значительному влиянию гетерологичной экспрессии аквапоринов и составил 2, 87 ± 0, 05, 2, 74 ± 0, 06, 2, 98 ± 0, 06 и 2, 87 ± 0, 08 мкм (среднее значение, n = 50 ± SE) в макете, HsAQP1, NtPIP1; 3, и AtPIP1; 2 штамма.

( A ) Частота дыхания в HsAQP1, NtPIP1; 3, AtPIP1; 2 и фиктивной деформации (контроль). ( B ) Время для общего потребления O 2 в HsAQP1, NtPIP1; 3, AtPIP1; 2 и фиктивной деформации (контроль). Сразу же после подачи воздуха в дрожжевую суспензию в среде SD-LU + с глюкозой, содержащей пузырьки N 2, для достижения концентрации насыщенного растворимого O 2, равной 235 мкмоль л -1, снижение концентрации O 2 в суспензии дрожжей контролировали и регистрировали по во-вторых, используя микросенсор O 2 . Звездочки указывают на статистически значимое различие с фиктивной деформацией (значения P показаны в таблице ниже) (ANOVA, тест Тьюки, P ≤ 0, 05, n = 6 ± SE).

Изображение в полном размере

Обилие транскрипта PIP и уровень АТФ в корнях табака при гипоксии

Мы исследовали уровни транскриптов растений табака, подвергнутых вызванной наводнением гипоксии в культуре минерального раствора в течение двух и семи дней. После двух дней гипоксии (≈125 мкмоль L -1 O 2 ) уровни транскрипции листьев и корней NtPIP1 ; 3 (аквапорин, демонстрирующий высокую скорость транспорта O 2 ), увеличился примерно в четыре раза по сравнению с хорошо аэрированными (≈500 мкмоль L -1 O 2 ) растениями (Fig. 6A, B). У хорошо аэрированных растений уровни транскрипта аквапорина оставались одинаковыми на второй и седьмой дни в листьях и корнях (рис. 6A-D). Относительно незначительные увеличения были также измерены для уровней транскрипта NtPIP1 ; 4 в листьях и NtPIP1 ; 1 и NtPIP1 ; 2 в корнях (рис. 6А, Б). Через семь дней наблюдается резкое увеличение NtPIP1 ; 3 измеряли в гипоксических листьях (примерно в 12 раз выше, чем в аэрированном контроле) и в корнях (примерно в 22 раза выше, чем в аэрированном контроле) (фиг. 6C, D). Было также примерно трехкратное увеличение NtPIP2 ; 1 в листьях (рис. 6в). При лечении гипоксии, со второго по седьмой день, NtPIP1 ; 3 уровня транскрипта резко возросли как в листьях ( P = 0, 0001), так и в корнях ( P = 0, 0037) (рис. 6), что сопровождалось значительным увеличением уровней АТФ в апикальных сегментах корня (рис. 7; P = 0, 0267), После семи дней лечения гипоксические и хорошо аэрированные корни имели одинаковые уровни АТФ в каждом сегменте корня (рис. 7В). Гипоксические растения показали здоровый и зеленый вид, без хлороза и других видимых признаков дефицита O 2 .

Относительное содержание транскрипта выбранных PIP в листьях ( A ) и корнях ( B ) после 2 дней воздействия и в листьях ( C ) и корнях ( D ) после 7 дней воздействия. Количество транскрипта PIP s измеряли стандартным методом кривой в анализе qRT-PCR с нормализацией по среднему геометрическому значению для двух эталонных генов, EF1-α и L25 . Звездочки указывают на разницу в значимости в экспрессии генов между хорошо аэрированным и гипоксическим лечением в один и тот же день; Значения P для сравнений между вторым и седьмым днями перечислены в таблице ниже (ANOVA, тест Тьюки, P ≤ 0, 05, n = 6 ± SE).

Изображение в полном размере

( A ) Уровни АТФ после 2 дней лечения. ( B ) Уровни АТФ после 7 дней лечения. Уровень АТФ определяли путем определения биолюминесценции в реакции Люцифераза / Люциферин. Звездочки указывают на значительные различия в уровнях АТФ между хорошо аэрированной и гипоксической обработками в одной и той же ткани в один и тот же день; Значения P для сравнений между вторым и седьмым днями перечислены в таблице ниже (ANOVA, тест Тьюки, P ≤ 0, 05, n = 6 ± SE).

Изображение в полном размере

обсуждение

В этом исследовании мы исследовали потенциальный вклад аквапоринов в трансмембранный транспорт O 2 в цельных клетках дрожжей и протопластах дрожжей, измеряя поглощение вблизи пиковых длин волн миоглобина во времени. В цельноклеточном анализе A 541 увеличивался в течение первых 60 с, что позволило нам провести скрининг штаммов, которые экспрессировали предполагаемые O 2 -транспортирующие аквапорины (Fig. S3B). Изменения в A 541, вероятно, представляют собой комбинацию нескольких процессов, включая диффузию O 2, оксигенацию дезоксимиоглобина, конверсию между оксимиоглобином и метмиоглобином и потребление O 2 . Присутствие клеточных стенок может препятствовать изменениям поглощения в миоглобине и привести к недооценке диффузии O 2 при предварительном скрининге. Кроме того, при смешивании дрожжевой суспензии и аэрированного буфера могут возникать возможные артефакты при измерении оптической плотности. Дрожжевой анализ протопластов был направлен на устранение этих потенциальных ловушек с многочисленными мерами предосторожности и большим количеством повторов и на максимизацию сигнала оксигенации миоглобина. Результаты показали, что ∆A 319 / ∆A 341 в анализе протопластов дрожжей также может быть высокочувствительным параметром при измерении транспорта O 2 через аквапорины.

Сообщалось, что аквапорин человека HsAQP1, который, как мы обнаружили, усиливает оксигенацию миоглобина, облегчая прохождение O 2, облегчает транспорт CO 2 при гетерологичной экспрессии в ооцитах Xenopus laevis 15 . Однако другие основные аквапорины, переносящие СО 2, включая AtPIP1; 2 5, NtPIP1; 2 3 и LbAQP1 6, не способствовали переносу O 2 при экспрессии в дрожжах (рис. S3B). Это говорит о том, что аквапориновые ортологи развили определенную степень специфичности для транспорта O 2 . Выравнивание всех 20 проанализированных аквапоринов не показывает консенсусных остатков, которые являются исключительными для O 2 -транспортирующих аквапоринов (Примечание S3). Похоже, что консервированные остатки зависят от вида, а не имеют отношение к транспортной способности. Тем не менее, следует отметить, что все шесть O 2 -транспортирующих аквапоринов имеют хорошо сохранившиеся 29 аминокислотных остатков у разных видов, включая большинство сигнатурных мотивов Asn-Pro-Ala (NPA) и селективные фильтры остатков Ar / R (Примечание S4 ). В NtPIP1; 3 остаток аспарагина, обычно во втором мотиве NPA, замещен треонином (Thr-235), который может потенциально иметь отношение к его сильно увеличенной способности переносить O 2 .

Расчеты проникновения гидрофобных газов (O 2, CO 2 и NO) последовательно показали аналогичные значения энергетического барьера 5–6 ккал моль -1 через водные поры 16, 17 . Системы моделирования мембранных белков тетрамера HsAQP1 человека продемонстрировали наличие поры, расположенной в центре между четырьмя мономерами, которая выстлана в значительной степени гидрофобными остатками и может участвовать в транспорте газов, а не воды 16, 18 . Можно предположить, что наличие и точная структура этой поры придают газотранспортную специфичность различным аквапоринам. В доказанном правильном, свойства стробирования этой поры могут быть направлены на изменение скорости трансмембранного прохождения газов.

Результаты скорости поглощения O 2 дрожжами подтверждают результаты анализа транспорта O 2, указывая на значимость опосредованного порами транспорта для дыхания. Повышенные уровни транскрипта HsAQP1, также иногда сопровождаемые другими аквапоринами, обычно сообщаются для раковых клеток 19, 20, причем уровень экспрессии HsAQP1 часто коррелирует с ростом клеток, степенью опухоли 20, 21 и метастазированием 22, 23 . Также сообщалось, что делеция HsAQP1 была эффективной в уменьшении размера опухоли молочной железы, а метастазирование в легкие 23 и молчание HsAQP1 ингибировали пролиферацию и инвазивность клеток остеосаркомы 24 . Хотя предлагаемые объяснения связей между экспрессией HsAQP1 и ростом злокачественных новообразований были в основном сфокусированы на переносе воды, следует также рассмотреть связь между высокой потребностью в O 2 для быстро растущих раковых клеток и облегчением транспорта O 2 посредством HsAQP1.

Поскольку сообщения о гипоксии-индуцированной экспрессии HsAQP1 25, 26 позволяют предположить, что аквапорин-опосредованные транспортные процессы могут быть особенно важными в условиях низкого содержания O 2, мы исследовали уровни транскриптов растений N. tabacum, подвергнутых вызванной наводнением гипоксии. Хотя уровни АТФ показали некоторое снижение в хорошо аэрированных растениях через 7 дней по сравнению с 2 днями (рис. 7А, В), обратная тенденция наблюдалась у растений, подвергшихся корневой гипоксии, что приводило к сходным уровням АТФ в листьях и всех корневых сегментах гипоксические и хорошо аэрированные растения после 7 дней гипоксии (рис. 7А, Б). Результаты показывают, что после начального гипоксического стресса растения, вероятно, получали достаточное количество кислорода для поддержания аэробного дыхания, поскольку гипоксические растения имели здоровый и зеленый вид и не имели хлороза или других видимых признаков дефицита O 2 . В то время как устойчивость к гипоксии корня может быть объяснена у некоторых растений увеличением подачи O 2 в клетки корня посредством развития специализированных аэрирующих структур, таких как аэренхима, процессы устойчивости растений к гипоксии при отсутствии явных структурных изменений остаются неясными, В нашем исследовании не было структурных особенностей, присутствующих в корнях и стеблях растений, подверженных гипоксии корней, которые могли бы свидетельствовать об улучшенной доставке O 2 . Следовательно, увеличение NtPIP1 ; 3 уровня транскрипции (рис. 6) могут быть среди важных факторов, способствующих улучшению аэрации корня, подобно повышенным уровням транскрипта HsAQP1 в гипоксических тканях человека 25, 26 . Очевидно, что связь между опосредованным порами транспортом O 2 и гипоксией заслуживает дальнейшего внимания.

В заключение, наши результаты показывают, что некоторые из изученных растений и человеческих аквапоринов могут быть вовлечены в транспорт O 2 . Клетки дрожжей, гетерологически экспрессирующие эти аквапорины, сохраняли более высокие скорости поглощения O 2 в жидкой культуре, а растения табака демонстрировали резкое увеличение предполагаемого переноса O 2 аквапорина после того, как их корни подвергались гипоксическим условиям. Эти увеличения содержания O 2, транспортирующих аквапорины, после семидневного лечения гипоксии сопровождались повышением уровня АТФ в гипоксических сегментах апикального корня. Результаты исследования подтверждают, что функциональному значению поро-опосредованного транспорта O 2 следует уделять больше внимания.

методы

Экспрессия миоглобина и аквапоринов в дрожжах

Полная ORF миоглобина кашалота ( Physeter macrocephalus ) (инвентарный номер NCBI J03566.1 ) была субклонирована из pMB413 12 в вектор экспрессии дрожжей pAG425GAL-ccdB (//www.addgene.org/yeast-gateway/), технология Gateway (Invitrogen, Карлсбад, Калифорния, США). Полные ORF из 20 представляющих интерес генов аквапоринов были субклонированы из pGEM-T Easy в вектор экспрессии дрожжей pAG426GAL-ccdB (//www.addgene.org/yeast-gateway), соответственно, тем же способом. Эти гены включают три аквапорина животных из Homo sapiens – HsAQP1 ( DQ895575 ), HsAQP2 ( CR542024 ) и HsAQP3 ( CR541991 ), 12 аквапоринов растений – NtPIP1 ; 1 ( AF440271 ), NtPIP1 ; 2 ( AF024511 ), NtPIP1 ; 3 ( U62280 ), NtPIP1 ; 4 ( DQ914525 ), NtPIP2 ; 1 ( AF440272 ) и NtXIP1 ; 1 ( HM475294 ) из Nicotiana tabacum и AtPIP1 ; 1 ( AT3G61430 ), AtPIP1 ; 2 ( AT2G45960 ), AtPIP1 ; 3 ( AF348574 ), AtPIP1 ; 4 ( AT4G00430 ), AtPIP1 ; 5 ( AT4G23400 ) и AtNIP2 ; 1 ( AT2G34390 ) от Arabidopsis thaliana и пять грибных аквапоринов из Laccaria bicolor – LbAQP1 ( JQ585592 ), LbAQP3 ( JQ585593 ), LbAQP5 ( JQ585594 ), LbAQP6 ( JQ585595 ) и JbA5596 ( Jb585596 ). Конструкции были проверены с использованием праймера GAL1 (AATATACCTCTATACTTTAACGTC) при секвенировании Sanger. Штамм Saccharomyces cerevisiae INVSc1 (MATa his3D1 leu2 trp1-289 ura3-52; Invitrogen) дважды трансформировали вектором pAG425GAL-ccdB + миоглобин и одним из векторов PAG426GAL-ccdB + аквапорин, следуя протоколу мелкомасштабной трансформации дрожжей Invit (Invit ). Для ложного контроля INVSc1 трансформировали вектором pAG425GAL-ccdB + миоглобин и пустым вектором PAG426GAL-ccdB.

Выбор был основан на комплементации ura3 и leu2. Трансформированные дрожжи культивировали в синтетической полной среде, содержащей глюкозу, без Ura / Leu (United States Biological) (2 г азотной основы дрожжей, 2 г аминокислот с отсадкой, 5 г (NH 4 ) 2 SO 4, 30 г глюкозы в 1 л среды SD-LU + глюкоза, pH = 6) в течение 24 ч при 1, 2 × g и 30 ° C. Культуры разбавляли до оптической плотности OD 600 = 0, 6. Экспрессия гетерологичного белка индуцировалась путем изменения источника углерода среды с глюкозы на галактозу (30 г в 1 л среды SD-LU + галактоза) и выращивания дрожжевых клеток в течение 24 ч (1, 2 × g, 30 ° C) с 25 мг L -1 FeSO 4 в качестве источника железа, способствующего образованию структуры, связывающей миоглобин-железо 27, подтвержденной с помощью количественного анализа RT-PCR 28, 29 (метод S1), иммуноблоттинга (метод S2) и косвенного иммунофлуоресцентного определения (метод) S3).

Транспортный анализ O

2

Дрожжи дважды промывали в буфере KH 2 PO 4 (0, 1 М, pH 6), а затем суспендировали в буфере KH 2 PO 4 с пузырьками N 2 . Дрожжевую суспензию барботировали с N 2 в течение 30 с и вакуумировали в течение 30 мин, чтобы минимизировать растворимый O 2 в дрожжевой суспензии, что имеет решающее значение для поддержания состояния дезоксимиоглобина 30, 31 . Спектр между 500 нм и 600 нм суспензии дрожжей сканировали после истощения O 2 и повторной аэрации. По сравнению со спектром очищенного миоглобина 31, спектр дрожжевой суспензии позволяет предположить, что состояние метмиоглобина, вероятно, было доминирующим по сравнению с дезоксимиоглобином и оксимиоглобином. Кроме того, спектр поглощения суспензии дрожжевых клеток, вероятно, является более сложным, чем очищенные белки миоглобина. Несмотря на эти ограничения, изменение A 541 после реаэрации было заметно (рис. S3A), которое находилось в диапазоне 541–543 нм, т.е. пик поглощения очищенного оксимиоглобина в исследовании Zhao et al . 30, а также в наших наблюдениях (рис. S2). Увеличение A 541 отражает превращение дезоксимиоглобина в оксигенированное состояние при связывании Fe 2+ – O 2, что можно объяснить притоком O 2 . Скорость увеличения A 541 (ΔA 541 с -1 ) может отражать способность поглощения O 2 штаммами дрожжей, экспрессирующими различные аквапорины. Поэтому поглощение 1 мл дрожжевой суспензии каждого штамма регистрировали при 541 нм в течение 2 мин с интервалом в 1 с сразу после добавления 1 мл насыщенного воздухом буфера KH 2 PO 4 или N 2 -насыщенного KH 2 PO 4 как отрицательное контроль, соответственно, с использованием спектрофотометра (Thermo Genesys 10S V4.002, ThermoFisher Scientific). Все измерения проводились при 22 ° С. Среднее значение и стандартная ошибка были рассчитаны на основе шести биологических повторений. CM-H 2 DCFDA 32 использовали для индикации окислительного состояния выбранных штаммов дрожжей вследствие такой предварительной обработки и для определения способности переносить H 2 O 2 выбранных аквапоринов 33 (методы S4).

После скрининга штаммов, которые экспрессировали предполагаемые O 2 -транспортирующие аквапорины, путем измерения увеличения A 541 в течение 60 с с помощью спектрофотометра (рис. S3B), дрожжевые протопласты были приготовлены для отобранных для анализа очищенного транспорта O 2 . После индукции 4 мл дрожжевой культуры при OD 600 = 2 каждого штамма собирали, предварительно инкубировали, промывали и обрабатывали зимолазой (Yeast lyticase 100 T, United States Biological) при 37 ° С, 50 об / мин в течение 2 часов. Протопласты дрожжей ресуспендировали в 10 мл ферментного буфера (1, 2 М сорбита, 50 мМ ацетата магния, 10 мМ CaCl 2 в автоклавированной деионизированной дистиллированной воде). Для исходного состояния, обедненного кислородом, спектр поглощения сканировали от 300 нм до 650 нм сразу после смешивания 500 мкл суспензии протопласта с 500 мкл изосмотического аскорбатного буфера натрия (0, 6 М аскорбата натрия, 50 мМ ацетата магния, 10 мМ CaCl 2 в автоклавированной деионизированной дистиллированной воде). Последовательное сканирование проводилось после каждых 30 с прямой аэрации в моменты времени 30 с, 90 с, 150 с и каждую минуту до 10- й минуты. При 541–543 нм миоглобин в кислородсодержащем состоянии имеет ярко выраженный пик поглощения 31 (рис. S2). При длине волны 319–330 нм как у миоглобина (рис. S2), так и у миоглобина-экспрессирующих протопластов дрожжей обнаружен второй, гораздо более выраженный пик поглощения в кислородсодержащем состоянии (рис. S4B – E), который отсутствовал у нетрансформированного штамма дрожжей (рис. S4A). Значение A 319 / A 341 резко увеличилось вместе с многократной аэрацией (рис. S5C), что позволяет предположить, что A 319 / A 341 является хорошим индикатором оксигенации миоглобина. Следовательно, и ∆A 541 / ∆A600, и ∆A 319 / ∆A 341 были рассчитаны для представления изменения оптической плотности вследствие оксигенации миоглобина. Статистически значимое различие по всем штаммам анализировали в ΔA 541 / ΔA 600 протопластов дрожжей через 90 с (ANOVA, тест Тьюки, P ≤ 0, 05, n = 19; значения P показаны в таблице на рис. 3) и в ∆A 319 / ∆A 341 через 5 минут с 5-кратным увеличением аэрации по 30 с (ANOVA, тест Тьюки, P ≤ 0, 05, n = 6; значения P показаны в таблице на рис. 4).

$config[ads_text16] not found

Для сканирования спектра миоглобина очищенный белок миоглобина лошади в концентрации 1 мг / мл смешивали с 1 объемом 10% аскорбата натрия для создания дезоксигенированного состояния с последующей упомянутой выше серией аэрации для достижения состояния оксимиоглобина.

Поглощение кислорода дрожжами

Скорости поглощения O 2 в дрожжевой суспензионной культуре непрерывно контролировали в течение 40 минут в штаммах со сверхэкспрессией и имитацией (фиг. S8). Время, необходимое для того, чтобы культуры дрожжевой суспензии истощали O 2 из раствора, также измеряли с глюкозой в качестве источника углерода. Штаммы S. cerevisiae INVSc1 для экспрессии HsAQP1, или NtPIP1; 3, или AtPIP1; 2, и имитирующий контрольный штамм культивировали и индуцировали для экспрессии гетерологичного белка, как описано выше. Дрожжи дважды промывали в буфере KH 2 PO 4 (0, 1 М, рН 6), а затем суспендировали в 15 мл среды N- 2 с пузырьками SD-LU +, содержащей глюкозу, в 50-мл пробирках Falcon до достижения OD 600 = 5. подают в дрожжевую суспензию до тех пор, пока концентрация растворимого O 2 не достигнет примерно 235 мкмоль л -1, стабильный уровень насыщения негазированной среды при 25 ° C. Начиная с этого момента, снижение концентрации O 2 в дрожжевой суспензии контролировали и регистрировали в секунду, используя микросенсор O 2 с диаметром наконечника 50 мкм (OX-50), подключенный к OXY-Meter, компактному микросенсорному усилителю O 2 ( Unisense, Орхус, Дания). Парафильм использовался для герметизации и минимизации диффузии свободного воздуха в трубки Сокола. Наклоны снижения концентрации O 2 в течение начальных 0–1000 с были рассчитаны с помощью линейной регрессии, в которой абсолютные значения представляли показатели потребления O 2 различными штаммами дрожжей в течение соответствующих интервалов. Время истощения O 2 каждой дрожжевой суспензии регистрировали. Средние значения и стандартные ошибки были рассчитаны на основе шести биологических повторений.

Исследование гипоксии корня табака: условия роста и лечение

Семена табака (Nicotiana tabacum L.) прорастали в почве, а растения выращивали в течение двух недель в комнате для выращивания с контролируемой средой, в которой поддерживались температуры 22/18 ° C (день / ночь), относительная влажность 60 ± 10% и 18 часов. фотопериод с плотностью фотосинтетического потока фотонов около 350 мкмоль м -2 с -1 . После двухнедельного роста растения переносили в контейнеры с модифицированным половинным раствором Хоагланда, аэрировали с помощью аквариумных насосов (растворенный O 2 составлял приблизительно 7, 5 мг л -1 ). Тридцать шесть растений были случайно размещены в шести контейнерах. Через одну неделю растения в трех контейнерах подвергали гипоксии путем промывки воды газообразным азотом до достижения уровня растворенного O 2, равного 2 мг л -1, и затем оставались на месте. Растения в трех других контейнерах продолжали аэрироваться.

Количественная ОТ-ПЦР в табаке

Корни и листья были отобраны после двух и семи дней лечения гипоксии ( n = 6). Образцы ткани замораживали и гомогенизировали в жидком азоте с использованием ступки и пестика. Тотальную РНК экстрагировали с использованием RNeasy Plant Mini Kit (Qiagen, Valencia, CA, USA). Синтез кДНК и КПЦР проводили, как описано в методе S1. Расшифровка стенограммы NtPIP1 ; 1, PIP1 ; 2, PIP1 ; 3, PIP1 ; 4 и PIP2 ; 1 нормализовали относительно среднего геометрического значения двух эталонных генов, EF1-α и рибосомного белка L25 . Ген-специфические праймеры были сконструированы с использованием Primer Express 3.0 (Applied Biosystems, Life Technologies) (Таблица S2).

Определение уровня АТФ

Уровни АТФ измеряли в листьях и верхушечных, центральных и базальных сегментах корня после 2 и 7 дней гипоксии и у хорошо аэрированных растений. Корни и листья табака отбирали после двух и семи дней обработки. Корни были разделены на базальный, апикальный и центральный сегменты. Образцы ткани измельчали ​​и 50 мг измельченных образцов помещали в 600 мкл охлажденной льдом 5% трихлоруксусной кислоты (ТСА) 34 в 2 мл центрифужные пробирки. Образцы энергично встряхивали в течение 20 с, оставляли на льду на 10 мин и центрифугировали при 10000 × g, 4 ° С в течение 10 мин. Каждые 400 мкл супернатанта собирали и добавляли к 400 мкл охлажденного на льду трис-ацетатного буфера (рН = 7, 75, 1 М). Для анализа АТФ 4 мкл смеси пипеткой переносили в 96 мкл воды без АТФ в лунку 96-луночного планшета (96-луночный планшет Costar с плоским дном). Для количественного определения АТФ в каждую лунку добавляли 50 мкл реагента rLuciferase / Luciferin из набора для анализа ATP ENLITEN (Promega, Madison, WI, USA), и стандартную кривую готовили в соответствии с протоколом производителя. Биолюминесцентный сигнал 35 детектировали с использованием устройства для считывания микропланшетов (Fluostar Optima, BMG Labtech, Ortenberg, Germany).

Статистический анализ

Средние значения и стандартные ошибки были рассчитаны на основе биологических повторений в каждом анализе по описательной статистике. Статистическая разница была проанализирована с использованием одностороннего ANOVA (критерий Тьюки, P ≤ 0, 05).

Дополнительная информация

Как цитировать эту статью : Zwiazek, JJ et al . Значение транспорта кислорода через аквапорины. Sci. Отчет 7, 40411; doi: 10.1038 / srep40411 (2017).

Примечание издателя: Springer Nature остается нейтральным в отношении юрисдикционных претензий на опубликованных картах и ​​институциональных принадлежностей.

Дополнительная информация

Word документы

  1. 1.

    Дополнительная информация

Комментарии

Отправляя комментарий, вы соглашаетесь соблюдать наши Условия и Принципы сообщества. Если вы обнаружили что-то оскорбительное или не соответствующее нашим условиям или правилам, отметьте это как неуместное.

Перенос веществ через мембрану

В процессе жизнедеятельности клетке требуется непрерывный обмен различными веществами с внеклеточной средой.

Обмен происходит путем пассивного транспорта, когда вещества поступают в клетку по градиентам концентрации, например кислород, диоксид углерода, глюкоза, или путем осмоса (вода). Но клетка может транспортировать вещества и против концентрационных или электрических градиентов. Такой транспорт требует затрат энергии и называется активным. Обмен происходит при помощи специальных белков-переносчиков, образующих в мембране каналы. Эти белки специфичны для каждого транспортируемого вещества.

Пассивная диффузия по градиенту концентрации. Она осуществляется в обе стороны в зависимости от парциального давления (концентрации) того или иного вещества в объеме межклеточного вещества и в структурах клетки. Скорость диффузии зависит от степени проницаемости слоев мембраны для конкретного вещества. В свою очередь, проницаемость — величина, зависящая от размеров молекулы, ее гидрофильности или гидрофобности, особенностей структурных элементов мембраны, внеклеточных и внутриклеточных образований.

Пассивно проникают некоторые низкомолекулярные вещества, в том числе растворенные газы: кислород, азот, диоксид углерода. Скорость диффузии газов различна и зависит от размеров молекулы. В качестве примера рассмотрим распределение растворенного кислорода. Для диффузии газов в клетке нет специальных приспособительных механизмов, и распределение кислорода определяется степенью его растворимости в той или иной биологической среде, скоростью поступления с кровью, его содержанием в гемоглобине, факторами, влияющими на скорость диссоциации оксигемоглобина на гемоглобин и свободный кислород. Кроме того, имеет значение расстояние клетки от сосуда, скорость утилизации кислорода, проницаемость межклеточного вещества и некоторые другие факторы. При условии максимального учета этих факторов можно математически смоделировать содержание кислорода в микроанатомических структурах, в том числе отдельных зонах клетки.

Вода также диффундирует через мембрану, но в отличие от газов для ее диффузии на некоторых клетках имеются специальные белковые комплексы (аквапорины). Закрытые аквапорины могут затруднять диффузию воды.

Через мембрану могут свободно диффундировать жирорастворимые вещества, в том числе спирты, циклические органические соединения, жирные кислоты, мочевина.

Облегченная диффузия. Она протекает с помощью высокоспециализированных белков-переносчиков (транслоказ) и зависит от функциональной активности клетки. Белки-переносчики формируют «каналы» («открытые», «закрытые»), через которые проникают вещества в клетки. Облегченная диффузия отличается большей скоростью, явлением насыщения и возможностью гормональной регуляции.

Облегченная диффузия тесно связана с активным транспортом. Эти два процесса обычно осуществляют одни и те же каналы. При этом перенос вещества в сторону малой его концентрации может служить энергетическим механизмом, который сопровождает активный транспорт. При транспорте ионов кроме градиента концентрации имеет значение электрический градиент между отрицательной внутриклеточной и положительной внеклеточной средами (мембранный потенциал). Мембранный потенциал усиливает транспорт катионов и препятствует транспорту анионов в клетку и составляет энергетический компонент активного транспорта. Электрический градиент позволяет перемешаться иону с высокой скоростью, но при увеличении концентрации вещества наступает момент, когда дальнейшее повышение его концентрации или стимуляция клетки не ведет к усилению скорости обмена — явление насыщения. Оно обусловлено тем, что все каналы, транспортирующие данное вещество, задействованы и не могут усилить скорость перемещения через мембрану.

Облегченная диффузия является гормонозависимым процессом, то есть ее регулируют соседние клетки и общеорганизменные механизмы гуморального контроля.

Калиевые, натриевые и катионные каналы обеспечивают облегченную диффузию. Калиевые каналы имеются в клеточной мембране многих клеток. Они постоянно открыты, благодаря чему в клетке идут потери калия, которые восстанавливаются с помощью калий-натриевого насоса. В результате функции калиевых каналов устанавливается динамическое равновесие, и клетки поддерживают определенный трансмембранный потенциал.

Натриевый канал встречается лишь в мембранах, способных формировать потенциал действия (нейроны, мышечные волокна и клетки). Натриевые каналы открываются только в момент возбуждения. Открытие канала приводит к внедрению натрия внутрь клетки и деполяризации клеточной мембраны — возбуждению клетки. Чем выше концентрация ионов кальция вне клетки, тем труднее открываются натриевые каналы. Если вне клетки концентрация ионов кальция падает, то возбудимость мембран резко возрастает — вплоть до общих судорог (тетании).

Катионные каналы находятся в мембранах, содержащих Н-холинорецепторы. При взаимодействии рецепторов с ацетилхолином канал открывается, ионы натрия и калия начинают свободно диффундировать по градиенту концентрации. Это ведет к деполяризации мембраны и возбуждению клетки. Подобно на канал воздействует никотин.

Активный транспорт. Этот вид транспорта через клетку идет с затратами энергии, против градиента концентрации. Он высокоспецифичен и нередко сопряжен с транспортом двух веществ в противоположном направлении. Так в клетку попадают ионы калия и одновременно выводятся ионы натрия, транспортируются ионы хлора в обмен на гидрокарбонат и др. Активный транспорт поддерживает мембранный потенциал клетки.

Мембранный потенциал сохраняется клеткой за счет градиентов (различий) концентрации ионов: катионов калия и натрия, анионов хлора. В состоянии покоя внутри клетки электрический заряд отрицательный, а вне клетки положительный. При торможении клетки происходит гиперполяризация мембраны и разность потенциалов увеличивается. При возбуждении в клетке происходит деполяризация мембраны с активизацией специфической (в том числе и секреторной) активности. Минимальный сигнал, вызывающий деполяризацию мембраны, называется пороговым. Более сильное раздражение — надпороговое, а слабое — подпороговое. Деполяризация мембраны клетки сопровождается ее возбуждением, то есть клетка начинает проявлять признаки специфической активности. В частности, для секреторных клеток это означает активацию выделения секреторных продуктов, для мышечных клеток — сокращение и др. Длительная деполяризация мембраны может привести к тяжелым нарушениям жизнедеятельности клетки, вплоть до ее гибели.

Для первично-активного транспорта используется энергия непосредственного расщепления АТФ до АДФ. Таким образом, функционируют ионные насосы: калий-натриевые, кальциевые, протонный насос митохондрий и др. Белки, которые транспортируют вещества через мембрану, способны одновременно разрушать АТФ, то есть обладают АТФазной активностью. Энергию для этого вида активного транспорта может давать и окислительно-восстановительный процесс в митохондриях. В ходе перемещения электронов по дыхательной цепи выделяется энергия, которая служит для откачки протонов из матрикса в межмембранное пространство. Это формирует протонный градиент, энергия которого используется для синтеза АТФ.

Вторично-активный транспорт отличается тем, что белки, которые обеспечивают транспортные механизмы, не способны разрушать АТФ. Энергию они получают за счет градиента концентрации какого-либо иона, чаще Na+. Таким образом, энергия АТФ используется для первоначального переноса ионов натрия из клетки. Так захватывается в клетку или выводится из нее часть ионов, молекулы глюкозы и аминокислот. Подобный транспорт идет по типу антипорта (ион и транспортируемое вещество перемещаются в одну сторону) или по типу антипорта (ион и транспортируемое вещество переносятся в противоположных направлениях).

Примером активного насоса или канала служит калий-натриевый насос, обеспечивающий движение ионов натрия и калия через клеточную мембрану. Внутриклеточная часть белка расщепляет молекулу АТФ. Это обеспечивает выведение из клетки трех ионов натрия и поступление двух ионов калия. Таким образом, внутри клетки поддерживается высокая концентрация калия (в 35 раз выше, чем вне клетки) и низкая концентрация натрия (в 14 раз ниже внеклеточной). Это важно для создания электрических потенциалов на мембранах, процесса возбуждения в нервных и мышечных клетках, нормального протекания других внутриклеточных процессов. Белок натрий-калиевого насоса — тетрамер и состоит из двух α- и двух β-субъединиц. Некоторые препараты, например сердечные гликозиды, могут тормозить функцию насоса.

Натрий-зависимый кальциевый насос выводит ионы кальция из клетки в обмен на ионы натрия, перемещающиеся внутрь клетки. При этом энергия ионов натрия используется для выведения ионов кальция. Обмен идет в пропорции одна молекула кальция на две молекулы натрия. Этот насос располагается на клеточной мембране.

В мембранах глад. ЭПС имеется кальциевый насос. Он является первично-активным, и всасывание кальция из гиалоплазмы в цистерны ЭПС происходит с разрушением молекул АТФ. Разрушение одной молекулы АТФ до АДФ достаточно для всасывания двух молекул кальция. Кальциевый насос следует отличать от кальциевого канала, который имеется на этих же мембранах. Через кальциевые каналы происходит облегченная диффузия из цистерн ЭПС в гиалоплазму при сокращении миофибрилл (возбуждении клетки).

Транспорт глюкозы внутрь клетки обеспечивает натрий-зависимый глюкозный насос за счет энергии, получаемой при поступлении в клетку ионов натрия. Таким образом, насос функционирует по типу симпорта, то есть направление обоих веществ совпадает. Для всасывания одной молекулы глюкозы нужен один ион натрия.

Эндоцитоз и экзоцитоз. Высокомолекулярные вещества, макромолекулярные комплексы транспортируются в клетку или выводятся из нее путем эндоцитоза или экзоцитоза.

Эндоцитоз — это поглощение веществ, а экзоцитоз — выделение веществ из клетки. Выделяют макроэндоцитоз (фагоцитоз) и микроэндоцитоз (пиноцитоз).

Макроэндоцитоз, или фагоцитоз, обеспечивает захват макромолекулярных комплексов, частей клеток, бактерий и др. При фагоцитозе образуются крупные пузырьки, окруженные мембраной, — фагосомы.

Микроэндоцитоз (пиноцитоз) приводит к образованию более мелких пузырьков и обеспечивает поглощение биополимерных соединений, диспергированных в межклеточном веществе (белков, полипептидов, гликопротеинов).

Поглощение высокомолекулярных веществ может быть опосредовано двумя способами. В первом случае эндоцитоз может осуществляться без связи с белками-рецепторами в специализированных областях клетки, в которых имеются специфические белки — белки слияния. Диспергированные в межклеточной жидкости вещества погружаются в клетку за счет приближения, а затем и конъюгации участков цитомембраны с формированием мелких пиноцитозных пузырьков (неокаймленных пузырьков).

Во втором случае эндоцитоз происходит через рецепторы. Захватываемая частица взаимодействует с рецепторами мембраны клетки. Это сопровождается изменением мембранного потенциала, активацией вторых посредников, прикреплением к внутренней поверхности мембраны белков — клатринов. Появляется впячинание мембраны клетки и формируется окаймленный пузырек, погружающийся в цитоплазму. После погружения клатрины отщепляются от пузырька и диспергируются в гиалоплазме. Такой эндоцитоз начинается со связывания на поверхности плазмолеммы поглощаемых веществ. Их присоединение к плазмолемме осуществляется рецепторными молекулами. После адсорбции веществ на поверхности плазмолемма начинает образовывать сначала небольшие впячивания внутрь клетки. Они могут иметь вид незамкнутых округлых пузырьков или представлять собой глубокие инвагинации (впячивания) внутрь клетки. Затем такие локальные впячивания отшнуровываются от плазмолеммы и в виде пузырьков свободно располагаются в гиалоплазме.

Эндоцитоз нередко сопровождается параллельным экзоцитозом — эти процессы служат для регулируемого переноса в эпителии (в эндотелии кровеносных сосудов).

При фагоцитозе бактерий, крупных частей клетки и др. фагоцитами (макрофагами, нейтрофилами и др.) происходит взаимодействие фагоцитируемой частицы с рецепторами на поверхности клетки и изменение внутриклеточного содержания кальция. Это ведет к изменению полимеризации тонких микрофиламентов и микротрубочек, вызывает формирование выпячивания цитолеммы (псевдоподии) с погружением крупной частицы внутрь клетки — образование фагосомы.

В дальнейшем эндоцитозные пузырьки, или эндосомы, могут сливаться друг с другом, расти, и в их внутренней полости кроме поглощенных веществ появляются гидролитические ферменты (гидролазы), поступающие из лизосом. Эти ферменты расщепляют биополимеры до мономеров, которые в результате активного транспорта через мембрану пузырька переходят в гиалоплазму. Таким образом, поглощенные макромолекулы внутри мембранных вакуолей подвергаются внутриклеточному пищеварению.

Экзоцитоз — процесс выделения содержимого секреторных включений, остаточных телец и др. из клетки. В этом случае внутриклеточные продукты (белки, мукополисахариды, липопротеиды и др.), заключенные в вакуоли или пузырьки и отграниченные от гиалоплазмы мембраной, подходят к плазмолемме. В местах контактов плазмолемма и мембрана вакуоли сливаются, и содержимое вакуоли поступает в окружающую среду.

Если вы нашли ошибку, пожалуйста, выделите фрагмент текста и нажмите Ctrl+Enter.

Транспорт веществ через мембраны – презентация онлайн

1.

Транспорт веществ через мембраны.

2. Функции мембран

1. Защитная.
2. Опорная.
3. Ограничительная.
4. Обеспечение связи между
клетками.
5. Место прохождения
биохимических реакций
6. Транспортная.
7. Регуляция обмена веществ
между клеткой и внешней
средой.
8. Рецепторная.

3. Свойства мембран

Мембраны обладают свойством
избирательной проницаемости,
то есть хорошо проницаемы для одних
вещества или молекул и плохо проницаемы
(или совсем непроницаемы) для других.

4. Функции мембран

В зависимости от необходимости
использования энергии для осуществления
транспорта веществ, различают:
пассивный транспорт – транспорт
веществ, идущий без затрат энергии;
активный транспорт – транспорт,
идущий с затратами энергии.

5. Виды транспорта

Пассивный транспорт
Перемещение веществ,
идущее без затрат энергии
Активный транспорт
Перемещение веществ,
идущее с затратами энергии

6.

Пассивный транспорт В основе пассивного транспорта лежит разность
концентраций и зарядов. Вещества всегда
перемещаются по градиенту концентрации. Если
молекула заряжена,
то на ее транспорт
влияет и
электрический
градиент.
Поэтому часто
говорят об
электрохимическом
градиенте.

7. Пассивный транспорт

Виды пассивного транспорта
Транспорт
веществ через
липидный
бислой (простая
диффузия)
Транспорт
веществ через
мембранные
каналы
Транспорт веществ
через специальные
транспортные белки
(облегченная
диффузия)

8. Пассивный транспорт

Простая диффузия – транспорт веществ
непосредственно через липидный бислой. Через
него легко проходят газы, неполярные или малые
незаряженные полярные молекулы. Чем меньше
молекула и чем более она жирорастворима, тем
быстрее она проникает через мембрану.

9. Транспорт воды через мембрану

Диффузию воды через мембраны называют
осмосом. Вода, очень быстро проникает через
липидный бислой. Это объясняется тем, что ее
молекула мала и электрически нейтральна.
Существуют и аквапорины – белки, обеспечивающие быстрое прохождение воды через мембрану.

10. Транспорт воды через мембрану

Диффузию воды через мембраны называют
осмосом. Вода, очень быстро проникает через
липидный бислой. Это объясняется тем, что ее
молекула мала и электрически нейтральна.
Существуют и аквапорины – белки, обеспечивающие быстрое прохождение воды через мембрану.

11. Транспорт воды через мембрану

При добавлении 10% раствора поваренной соли к
препарату кожицы лука наблюдается плазмолиз – ионы
Na+ и Сl- вызывают выход воды из протопласта клетки и
отставание протопласта от оболочки. При удалении
раствора соли и добавлении воды идет обратный
процесс – деплазмолиз – примеры осмоса.

12. Пассивный транспорт

Диффузия через мембранные каналы.
Заряженные молекулы и ионы (Na+, K+, Ca2+, Cl-)
не способны проходить через липидный бислой
путем простой диффузии, тем не менее, они
проникают через мембрану, благодаря наличию
в ней особых
каналообразующих
белков,
формирующих
различные каналы.

13. Пассивный транспорт

Облегченная диффузия —
транспорт веществ с помощью
специальных транспортных белков,
каждый из которых отвечает за
транспорт определенных молекул
или групп родственных молекул.
Они взаимодействуют с молекулой
переносимого вещества и какимлибо способом перемещают ее
сквозь мембрану.
Таким образом в клетку
транспортируются сахара,
аминокислоты, нуклеотиды и
многие другие полярные молекулы.

14. Виды транспорта

Пассивный транспорт
Перемещение веществ,
идущее без затрат энергии
Активный транспорт
Перемещение веществ,
идущее с затратами энергии

15. Активный транспорт

Виды активного транспорта
Натрийкалиевый
насос
Экзоцитоз
Эндоцитоз
Фагоцитоз
Пиноцитоз

16. Активный транспорт

Необходимость активного транспорта возникает
тогда, когда требуется обеспечить перенос через
мембрану молекул против электрохимического
градиента.
Этот транспорт
осуществляется
белками-переносчиками,
деятельность которых
требует затрат энергии.
Источником энергии
служат молекулы АТФ.

17. Активный транспорт

Концентрация K+ внутри
клетки значительно выше, чем
за ее пределами, а Na+ наоборот. Поэтому К+ через
калиевые каналы мембраны
пассивно диффундирует из
клетки, а Na+ через натриевые
каналы – в клетку.
Вместе с тем, для нормального
функционирования клетке
важно поддерживать
определенное соотношение
ионов К+ и Na+ в цитоплазме и
во внешней среде.

18. Натрий-калиевый насос

Натрий-калиевый насос, активно перекачивает
Na+ из клетки, а K+ в клетку. На его работу треть
всей энергии, необходимой для
жизнедеятельности клетки.
Насос –трансмембранный
белок мембраны,
способный измененять
свою конформацию и
присоединять к себе
2 иона К+, с наружной
стороны мембраны
и 3 иона Na+ с
внутренней стороны.

19. Натрий-калиевый насос

За один цикл работы насос выкачивает из клетки
3 Na+ и закачивает 2 К+ за счет энергии одной
макроэргической связи молекулы АТФ.

20. Активный транспорт

Эндоцитоз – процесс поглощения макромолекул
клеткой. При эндоцитозе плазматическая мембрана
образует впячивание, края ее сливаются, и
происходит отшнуровывание в цитоплазму везикул –
эндоцитарных вакуолей.

21. Активный транспорт

Фагоцитоз — захват и
поглощение крупных
частиц (например,
фагоцитоз лимфоцитов,
простейших и др
Пиноцитоз — процесс
захвата и поглощения
капелек жидкости с
растворенными в ней
веществами.

22. Активный транспорт

Экзоцитоз – процесс выведения различных веществ из
клетки. Содержимое везикулы выводится за пределы
летки, а ее мембрана включается в состав плазмалеммы.

23. повторение

1.
2.
3.
4.
Какие виды транспорта обозначены цифрами 1 — 4?
Какой вид транспорта требует затраты энергии?
Как жирорастворимые вещества попадают в клетку?
Как ионы Na+ выводятся из цитоплазмы клетки
наружу?

24.

повторение 1. Что называется плазмолизом?
2. Что называется осмосом?
3. Каким образом осуществляется движение воды
через клеточную мембрану?

25. повторение

1. Причины плазмолиза?
2. Чем обусловлен электрохимический градиент?

(PDF) Genetic Variants of Intron Region of Aquaporin AQP5 Gene and Development of Pulmonary Edema in Lung Infection Complicated by Septic Shock

GENERAL REANIMATOLOGY, 2016, 12; 322 www.reanimatology.com

DOI:10.15360/1813977920163823

5. Day R.E., Kitchen P., Owen D.S., Bland C., Marshall L., Conner A.C., Bill

R.M., Conner M.T. Human aquaporins: regulators of transcellular water

flow. Biochim. Biophys. Acta. 2014; 1840 (5): 1492—1506.

http://dx.doi.org/10.1016/j.bbagen.2013.09.033. PMID: 24090884

6. Verkman A.S. More than just water channels: unexpected cellular roles

of aquaporins. J. Cell Sci. 2005; 118 (Pt 15): 3225—3232.

http://dx.doi.org/10.1242/jcs.02519. PMID: 16079275

7. Mezzasoma L., Cagini L., Antognelli C., Puma F., Pacifico E., Talesa V.N.

TNFαregulates natriuretic peptides and aquaporins in human

bronchial epithelial cells BEAS2B. Mediators Inflamm. 2013; 2013:

159349. http://dx.doi.org/10.1155/2013/159349. PMID: 24369440

8. Bloch O., Manley G.T. The role of aquaporin4 in cerebral water trans

port and edema. Neurosurg. Focus. 2007; 22 (5): E3. http://dx.doi.org/

10.3171/foc.2007.22.5.4. PMID: 17613234

9. Li J., Xu M., Fan Q., Xie X., Zhang Y., Mu D., Zhao P., Zhang B., Cao F.,

Wang Y., Jin F., Li Z. Tanshinone IIA ameliorates seawater exposure

induced lung injury by inhibiting aquaporins (AQP) 1 and AQP5

expression in lung. Respir. Physiol. Neurobiol. 2011; 176 (1—2): 39—49.

http://dx.doi.org/10.1016/j.resp.2011.01.005. PMID: 21244858

10. Ning Y., Ying B., Han S., Wang B., Wang X., Wen F. Polymorphisms of

aquaporin5 gene in chronic obstructive pulmonary disease in a Chinese

population. Swiss Med. Wkly. 2008; 138 (39—40): 573—578.

http://dx.doi.org/10.2008/39/smw12240. PMID: 18853286

11. Adamzik M., Frey U.H., Möhlenkamp S., Scherag A., Waydhas C.,

Marggraf G., Dammann M., Steinmann J., Siffert W., Peters J. Aquaporin

5 gene promoter 1364A/C polymorphism associated with 30day sur

vival in severe sepsis. Anesthesiology. 2011; 114 (4): 912—917.

http://dx.doi.org/10.1097/ALN.0b013e31820ca911. PMID: 21427539

12. Dellinger R.P., Levy M.M., Rhodes A., Annane D., Gerlach H., Opal S.M.,

Sevransky J.E., Sprung C.L., Douglas I.S., Jaeschke R., Osborn T.M.,

Nunnally M.E., Townsend S.R., Reinhart K., Kleinpell R.M., Angus D.C.,

Deutschman C.S., Machado F.R., Rubenfeld G.D., Webb S.A., Beale R.J.,

Vincent J.L., Moreno R.; Surviving Sepsis Campaign Guidelines

Committee including the Pediatric Subgroup. Surviving sepsis campaign:

international guidelines for management of severe sepsis and septic

shock: 2012. Crit. Care Med. 2013; 41 (2): 580—637. http://dx.doi.org/

10.1007/s0013401227698. PMID: 23353941

13. Мороз В.В., Голубев А.М., Кузовлев А.Н. Отек легких: классифика

ция, механизмы развития, диагностика. Общая реаниматология.

2009; 5 (1): 83—88. http://dx.doi.org/10.15360/181397792009183

14. Tablan O.C., Anderson L.J., Besser R., Bridges C., Hajjeh R.; CDC;

Healthcare Infection Control Practices Advisory Committee. Guidelines

for preventing healthcare—associated pneumonia, 2003: recommenda

tions of CDC and the Healthcare Infection Control Practices Advisory

Committee. MMWR Recomm Rep. 2004; 53 (RR3): 1—36. PMID:

15048056

15. Гельфанд Б.Р., Яковлев С.В., Проценко Д.Н., Белоцерковский Б.З. Но

зокомиальная пневмония, связанная с искусственной вентиляци

ей легких: возможна ли стандартизация терапии? Consilium

Medicum. 2004; 6 (4): 245—248.

16. Pugin J., Auckenthaler R., Mili N., Janssens J. P., Lew P.D., Suter P.M.

Diagnosis of ventilator associated pneumonia by bacteriological analy

sis of bronchoscopic and non bronchoscopic «blind» bronchoalveolar

lavage fiuid. Am. Rev. Respir. Dis. 1991; 143 (5Pt 1): 1121—1129.

http://dx.doi.org/10.1164/ajrccm/143.5_Pt_1.1121. PMID: 2024824

17. Чучалин А.Г., Гельфанд Б.Р. (ред.). Нозокомиальная пневмония у

взрослых. Российские национальные рекомендации. М.; 2009: 92.

18. Мороз В.В., Голубев А.М., Кузовлев А.Н., Писарев В.М. Новые диа

гностические кандидатные молекулярные биомаркеры острого ре

спираторного дистресссиндрома. Общая реаниматология. 2014;

10 (4): 6—10. http://dx.doi.org/10.15360/1813977920144610

19. http://www.ncbi.nlm.nih.gov/projects/SNP

20. Newton C.R., Heptinstall L.E., Summers C., Super M., Schwarz M., Anwar

R., Graham A., Smith J.C., Markham A.F. Amplification refractory muta

tion system for prenatal diagnosis and carrier assessment in cystic

fibrosis. Lancet. 1989; 2 (8678—8679): 1481—1483.http://dx.doi.org/

10.1016/S01406736(89)929310. PMID: 2574768

21. Hamajima N., Katsuda N., Matsuo K., Saito T., Ito L.S., Ando M., Inoue

M., Takezaki T., Tajima K. Smoking habit and interleukin lB C31T

polymorphism. J. Epidemiol. 2001; 11 (3): 120—125. PMID: 11434423

22. Сальникова Л.Е., Чумаченко А.Г., Веснина И.Н., Лаптева Н.Ш., Куз

нецова Г.И., Абилев С.К., Рубанович А.В. Полиморфизм генов репа

рации и цитогенетические эффекты облучения. Радиационная би

ология. Радиоэкология. 2010; 50 (6): 656—662. PMID: 21434392

23. Егорова И.Н., Власенко А.В., Мороз В.В., Яковлев В.Н., Алексеев В.Г.

Вентиляторассоциированная пневмония: диагностика, профилак

тика, лечение (современное состояние вопроса). Общая реанима

тология, 2010; 6 (1): 79—88. http://dx.doi.org/10.15360/18139779

2010179

24. Pretto E.A. (ed.). Oxford textbook of transplant anaesthesia and criti

cal care. USA: Oxford University Press; 450.

Pharmacol. 2011; 9 (3): 287—291. http://dx.doi.org/10.2174/

157016111795495495. PMID: 21314629

5. Day R.E., Kitchen P., Owen D.S., Bland C., Marshall L., Conner A.C., Bill

R.M., Conner M.T. Human aquaporins: regulators of transcellular water

flow. Biochim. Biophys. Acta. 2014; 1840 (5): 1492—1506.

http://dx.doi.org/10.1016/j.bbagen.2013.09.033. PMID: 24090884

6. Verkman A.S. More than just water channels: unexpected cellular roles

of aquaporins. J. Cell Sci. 2005; 118 (Pt 15): 3225—3232. http://dx.doi.

org/10.1242/jcs.02519. PMID: 16079275

7. Mezzasoma L., Cagini L., Antognelli C., Puma F., Pacifico E., Talesa V.N.

TNFαregulates natriuretic peptides and aquaporins in human

bronchial epithelial cells BEAS2B. Mediators Inflamm. 2013; 2013:

159349. http://dx.doi.org/10.1155/2013/159349. PMID: 24369440

8. Bloch O., Manley G.T. The role of aquaporin4 in cerebral water trans

port and edema. Neurosurg. Focus. 2007; 22 (5): E3. http://dx.doi.org/

10.3171/foc.2007.22.5.4. PMID: 17613234

9. Li J., Xu M., Fan Q., Xie X., Zhang Y., Mu D., Zhao P., Zhang B., Cao F.,

Wang Y., Jin F., Li Z. Tanshinone IIA ameliorates seawater exposure

induced lung injury by inhibiting aquaporins (AQP) 1 and AQP5

expression in lung. Respir. Physiol. Neurobiol. 2011; 176 (1—2): 39—49.

http://dx.doi.org/10.1016/j.resp.2011.01.005. PMID: 21244858

10. Ning Y., Ying B., Han S., Wang B., Wang X., Wen F. Polymorphisms of

aquaporin5 gene in chronic obstructive pulmonary disease in a Chinese

population. Swiss Med. Wkly. 2008; 138 (39—40): 573—578.

http://dx.doi.org/10.2008/39/smw12240. PMID: 18853286

11. Adamzik M., Frey U.H., Möhlenkamp S., Scherag A., Waydhas C.,

Marggraf G., Dammann M., Steinmann J., Siffert W., Peters J. Aquaporin

5 gene promoter 1364A/C polymorphism associated with 30day sur

vival in severe sepsis. Anesthesiology. 2011; 114 (4): 912—917.

http://dx.doi.org/10.1097/ALN.0b013e31820ca911. PMID: 21427539

12. Dellinger R.P., Levy M.M., Rhodes A., Annane D., Gerlach H., Opal S.M.,

Sevransky J.E., Sprung C.L., Douglas I.S., Jaeschke R., Osborn T.M.,

Nunnally M.E., Townsend S.R., Reinhart K., Kleinpell R.M., Angus D.C.,

Deutschman C.S., Machado F.R., Rubenfeld G.D., Webb S.A., Beale R.J.,

Vincent J.L., Moreno R.; Surviving Sepsis Campaign Guidelines

Committee including the Pediatric Subgroup. Surviving sepsis campaign:

international guidelines for management of severe sepsis and septic

shock: 2012. Crit. Care Med. 2013; 41 (2): 580—637. http://dx.doi.org/

10.1007/s0013401227698. PMID: 23353941

13. Moroz V.V., Golubev A.M., Kuzovlev A.N. Otek legkikh: klassifikatsiya,

mekhanizmy razvitiya, diagnostika. Obshchaya Reanimatologiya.

[Pulmonary edema: classification, mechanisms of development, diag

nosis. General Reanimatology]. 2009; 5 (1): 83—88. http://dx.doi.org/

10.15360/181397792009183. [In Russ.]

14. Tablan O.C., Anderson L.J., Besser R., Bridges C., Hajjeh R.; CDC;

Healthcare Infection Control Practices Advisory Committee. Guidelines

for preventing healthcare—associated pneumonia, 2003: recommenda

tions of CDC and the Healthcare Infection Control Practices Advisory

Committee. MMWR Recomm Rep. 2004; 53 (RR3): 1—36. PMID:

15048056

15. Gelfand B.R., Yakovlev S.V., Protsenko D.N., Belotserkovsky B.Z.

Nozokomialnaya pnevmoniya, svyazannaya s iskusstvennoi ventilyat

siei legkikh: vozmozhna li standartizatsiya terapii? [Ventilatorassoci

ated nosocomial pneumonia: is there a possibility to standartoze treat

ment?] Consilium Medicum. 2004; 6 (4): 245—248. [In Russ.]

16. Pugin J., Auckenthaler R., Mili N., Janssens J.P., Lew P.D., Suter P.M.

Diagnosis of ventilator associated pneumonia by bacteriological analy

sis of bronchoscopic and non bronchoscopic «blind» bronchoalveolar

lavage fiuid. Am. Rev. Respir. Dis. 1991; 143 (5Pt 1): 1121—1129.

http://dx.doi.org/10.1164/ajrccm/143.5_Pt_1.1121. PMID: 2024824

17. Chuchalin A.G., Gelfand B.R. (red.). Nozokomialnaya pnevmoniya u

vzroslykh. Rossiiskie natsionalnye rekomendatsii. [Nosocomial pneumo

nia in adults. Russian national guidelines]. Moscow; 2009: 92. [In Russ.]

18. Moroz V.V., Golubev A.M., Kuzovlev A.N., Pisarev V.M. Novye diagnos

ticheskie kandidatnye molekulyarnye biomarkery ostrogo respiratornogo

distresssindroma. Obshchaya Reanimatologiya. [New diagnostic candi

date molecular biomarkers of acute respiratory distress syndrome.

General Reanimatology]. 2014; 10 (4): 6—10. http://dx.doi.org/

10.15360/1813977920144610. [In Russ.]

19. http://www.ncbi.nlm.nih.gov/projects/SNP

20. Newton C.R., Heptinstall L.E., Summers C., Super M., Schwarz M., Anwar

R., Graham A., Smith J.C., Markham A.F. Amplification refractory muta

tion system for prenatal diagnosis and carrier assessment in cystic

fibrosis. Lancet. 1989; 2 (8678—8679): 1481—1483.

http://dx.doi.org/10.1016/S01406736(89)929310. PMID: 2574768

21. Hamajima N., Katsuda N., Matsuo K., Saito T., Ito L.S., Ando M., Inoue

M., Takezaki T., Tajima K. Smoking habit and interleukin lB C31T

polymorphism. J. Epidemiol. 2001; 11 (3): 120—125. PMID: 11434423

22. Salnikova L.E., Chumachenko A.G., Vesnina I.N., Lapteva N.Sh.,

Kuznetsova G.I., Abilev S.K., Rubanovich A.V. Polimorfizm genov

reparatsii i tsitogeneticheskie effekty oblucheniya. [Polymorphism of

repair genes and cytogenetic radiation effects]. Radiatsionnaya

Original Observation

“Транспорт веществ через биологические мембраны”

МИНИСТЕРСТВО НАУКИ И ВЫСШЕГО ОБРАЗОВАНИЯ РОССИЙСКОЙ ФЕДЕРАЦИИ ФЕДЕРАЛЬНОЕ ГОСУДАРСТВЕННОЕ БЮДЖЕТНОЕ ОБРАЗОВАТЕЛЬНОЕ УЧРЕЖДЕНИЕ ВЫСШЕГО ОБРАЗОВАНИЯ «БАШКИРСКИЙ ГОСУДАРСТВЕННЫЙ УНИВЕРСИТЕТ» Биологический факультет Направление подготовки — Биология Курсовая работа на тему: «Транспорт веществ через биологические мембраны» Выполнила: студентка 3-го курса, группы А Сафина Илина Филюсовна Проверила: Доцент, к. б.н. Шпирная Ирина Андреевна Уфа – 2020 год 2 Содержание Введение……………………………………………………….…….….…….…….4 1. Функциональность биологических мембран…………..………….……………..6 2. Пассивный транспорт……………………………………………………….…….8 2.1. Диффузия………………………………………………………….……….…..10 2.1.1. Простая диффузия…………………………………….…………….………12 2.1.2. Облегчённая диффузия…………………………………………….……….15 2.1.2.1. Диффузия с подвижным переносчиком……………………….…………17 2.1.2.2. Диффузия с фиксированным переносчиком………………….…………19 2.2. Фильтрация…………………………………………………………….………20 2.3. Осмос…………………………………………………………………….……..21 2.3.1. Аквапорины………………………………………………………….………24 2.4. Элекродиффузия………………………………………………………….……24 2.5. Ионные каналы…………………………………………………………….….25 3. Активный транспорт………………………………………………………..…..27 3.1. Ионные насосы…………………………………………………………….….28 3.2. Механизмы переноса при помощи транспортёров или вторичный транспорт……………………………………………………………………………34 4. Мультимолекулярный перенос…………………………………………………36 4.1. Эндоцитоз ………………………………………………. .….…………….….36 4.1.1. Фагоцитоз…………………………………………………………..….…….37 5 3. Рассмотрение структуры биологической мембраны как системы транспорта веществ 4. Подробный разбор разнообразия видов транспорта через биомембраны 5. Обеспечение наличия основных формул и рисунков по выбранной мною теме, а также соблюдение терминологии 6 1. Функциональность биологических мембран Исследование физико-химических механизмов функционирования биомембран в нормальном состоянии, а также при воздействии модифицирующих агентов изучается важнейшим разделом мембранологии (науки о мембранах) и биофизики клетки. Этот раздел называют биофизикой мембран. Биологические мембраны — это функционально-активные структуры молекулярных размеров от 8 до 12 нм, состоящие в основном из белков и липидов. Это есть граница между клеткой и окружающей средой, то есть она ограничивает клетку (клеточные или плазматические мембраны) и внутриклеточные органоиды (например, мембрана митохондрий, хлоропласты, ЭПС) от внешней среды. Биомембраны имеют как общие функции, так и ряд специфических. К общим функциям мембран относятся: механическая, барьерная, метаболическая, матричная и коммуникационная. Специфические функции выполняются фотосинтетическими и энергосопрягающими мембранами (энергетическая функция), рецепторными мембранами (зрительная, обонятельная, терморецепция, химическая рецепция) и возбудимыми мембранами (генерация и проведение возбуждения). Большая часть процессов жизнедеятельности клетки, например, процессы всасывания и выделения, мышечного сокращения и проведения нервных импульсов, синтеза АТФ, связана с переносом веществ через мембраны. При большем отношении суммарной площади мембран к объему клетки возрастает интенсивность обменных процессов в клетке. [4,5,10,] 7 Рисунок 1. Жидкостно-мозаичная модель мембраны Очень важно различать два типа процессов транспорта веществ через биологические мембраны. Это транспорт низкомолекулярных веществ и транспорт высокомолекулярных соединений. К первому типу относится пассивный и активный транспорт, ко второму – экзо- и эндоцитоз. Часто транспорт полимеров относят к активному транспорту, но мы будем говорить о них раздельно, поскольку подробно рассмотрим все процессы, благодаря которым происходит транспорт через биомембраны. [5,6] 10 2.1. Диффузия Пассивный транспорт может осуществляться путём фильтрации, осмоса, а также двумя способами диффузии: простой и облёгченной. Диффузия — явление, при котором происходит проникновение растворённого вещества в ходе теплового хаотического движения молекул, из части с более высокой концентрацией в место с меньшей концентрацией, для уравновешивания концентрации в системе. Этот процесс с точки зрения математики показывает формула Фика: [5] Плотность потока вещества jm – количество вещества за единицу времени через единицу площади: 11 при пассивном транспорте зависимость плотности ионного потока от электрохимического градиента выражается уравнением Теорелла: Если в уравнение Теорелла добавим выражение для электрохимического потенциала, получим уравнение Нернста–Планка для разбавленного раствора: Таким образом, есть две причины переноса вещества в процессе пассивного транспорта: градиент концентрации dC/dx и градиент электростатического потенциала dϕ/dx. Есть случаи, когда в итоге связывания обеих причин происходит пассивный перенос вещества из области с меньшей концентрацией в область большей при помощи энергии электрического поля. Ситуация с неэлектролитами, когда Z = 0, или же в случае, когда электрическое поле постоянно (dϕ/dx = 0) уравнение Теорелла преобразуется: 12 По соотношению Эйнштейна, URT = D, где D – коэффициент диффузии; на выходе получаем закон Фика, о нём мы говорили выше. [8,11,12] 2.1.1. Простая диффузия Простая диффузия осуществляется путём переноса веществ через белковые поры, через поры липидного бислоя и собственно сквозь сам липидный бислой. Рисунок 3. Виды простой диффузии Поры в липидном бислое могут образовываться в результате: тепловых флуктуаций поверхности бислоя, электрического пробоя, замораживания плёнки, действия поверхностно-активных веществ, осмотического давления и, напоследок, в процессе перекисного окисления липидов. 15 Биологические мембраны имеют ещё второй вид диффузии, она называется облегчённой диффузией. 2.1.2. Облегчённая диффузия Облегчённая диффузия – это процесс переноса веществ через мембраны с помощью молекул-переносчиков. Эти молекулы по химической природе представляют собой белки, полипептиды или олигопептиды, которые имеют способность узнавать определённые вещества и транспортировать их через мембрану. При такой диффузии транспорт вещества идет по градиенту концентрации без какой-либо дополнительной затраты энергии. Здесь мы говорим о транспорте моносахаридов, аминокислот, нуклеотидов, глицерола, некоторых ионов и др. [5,8,12] Облегчённая диффузия имеет ряд особенностей, отличающих её от простой диффузии. Во-первых, она имеет высокую скорость переноса веществ, на порядок выше, чем простая диффузия. Во-вторых, переносу вещества при облегчённой диффузии свойственна кинетика насыщения. Суть её заключается в том, что при увеличении концентрации транспортируемого вещества скорость переноса возрастает лишь до определённого уровня, когда все молекулы переносчика связаны с переходящим веществом. То есть скорость диффузии достигает предельной точки, а далее скорость транспорта уже не будет увеличиваться, поскольку транспортная система полностью занята. 16 Рисунок 6. График, иллюстрирующий зависимость скорости переноса в клетку через мембрану от концентрации вещества во внеклеточном пространстве: 1 – простая диффузия; 2 – облегченная диффузия В-третьих, она обладает высокой специфичностью и избирательностью. К примеру, если переносчик может переносить различные виды молекул, то возникает их конкуренция. При этом одни молекулы транспортируются лучше, чем другие. Например, через мембраны эритроцитов, глюкоза переносится лучше, чем фруктоза; она лучше, чем ксилоза, далее арабиноза. И последнее: деятельность переносчиков может быть заблокирована некоторым веществом, если оно имеет похожую структуру с переносимым соединением. Так называемые ингибиторы, в частности, флоридзин подавляет транспорт сахаров через биомембрану. Следует обратить внимание, что деятельность белковых переносчиков мембраны имеет много общего с работой ферментов. [5,8-10] Облегченная диффузия всегда происходит при участии молекул- переносчиков. Она подразделяется на диффузию с подвижными и фиксированными переносчиками. К белкам-переносчикам относятся ферменты транслоказы и пермиазы. Они связывают своим активным центром вещество с одной поверхности 17 мембраны и переносят его через гидрофобный слой на другую поверхность мембраны.[8] 2.1.2.1. Диффузия с подвижным переносчиком При диффузии с подвижным переносчиком скорость проникновения веществ в клетку таких как: глюкоза, аминокислоты, глицерин, не носит линейной зависимости от разности концентраций. Ведь при определённом значении концентрации скорость проникновения значительно выше, в отличие от простой диффузии. При диффузии с подвижным переносчиком скорость транспорта вещества возрастает тогда, когда молекулы (А) данного вещества формируют комплекс с молекулами (Х) вспомогательного вещества. Значимой особенностью вспомогательного вещества является повышенная растворимость в липидах. На поверхности мембраны молекулы (А) присоединяются к молекулам (Х) и дальше комплексом (АХ) переносятся в клетку. Здесь комплекс демонтируется, молекулы вещества (А) освобождаются, а переносчик (Х) забирает у наружной поверхности мембраны уже новую молекулу переносимого вещества. Процесс переноса идет до момента полного выравнивания концентрации переносимого вещества по обеим сторонам мембраны.[4,9] Рисунок 7. Схема диффузии с подвижным переносчиком 20 частицы вещества свободного проходили по нему, именно поэтому они связываются с молекулами-переносчиками, передвигаясь от одной к другой. Рисунок 11. Схема диффузии с фиксированным переносчиком 2.2. Фильтрация Фильтрацией называется процесс движения раствора через поры из места с более высоким гидростатическим давлением, в область более низкого. Скорость переноса при фильтрации повинуется закону Пуазейля: 21 Фильтрация имеет огромное значение в процессе транспорта воды через станки кровеносных сосудов. [5,9,17] Рисунок 12. Механизм процесса фильтрации 2.3. Осмос Осмосом называют явление диффузии воды через мембраны. Осмос — это движение молекул воды через полупроницаемые мембраны (непроницаемые для растворенного вещества, но проницаемые для воды) из области, где концентрация растворенного вещества меньше, туда, где концентрация больше. 22 Рисунок 13. Схема осмотического процесса То есть частицы растворителя (синие) способны пересекать мембрану, частицы растворённого вещества (зеленые) — нет. Осмос имеет важное место во многих биологических процессах. Благодаря осмосу происходит гемолиз эритроцитов в гипотонических растворах, а также явление тургора в растительных клетках. [13] Подробнее рассмотрим роль осмоса в жизни клетки. Если её поместить в раствор с более высокой концентрацией веществ (гипертонический), чем в клеточном растворе, то вода приступит к выходу из клетки, следовательно, объём живого содержимого пойдёт на понижение. При помещении клетки в менее концентрированный, чем цитоплазма, раствор (гипотонический), транспорт воды происходит в обратном направлении — в клетку. Однако существуют пределы растяжимости цитоплазматической мембраны, и животная клетка в итоге разрывается. Явление разрыва эритроцитов в гипотоническом растворе называют осмотическим гемолизом. Необходимо учитывать внутриклеточную концентрацию веществ при приготовлении лекарственных препаратов, особенно для внутривенного введения, при 25 диффузионный поток ионов определяется градиентом электрохимического потенциала. (см. п. 2) [9,12] 2.5. Ионные каналы Как уже говорилось ранее, билипидный слой мембраны непроницаем для ионов. Электрически заряженные частицы могут транспортироваться через плазматическую мембрану лишь с помощью специальных структур – ионных каналов, которые образованы связанными между собой белковыми субъединицами, формирующих в мембране гидрофильную селективную пору. Ионные каналы мембраны представляют собой интегральные белки мембраны, образующие отверстия в мембране, заполненные водой. Они имеют независимый характер работы отдельных каналов. В плазматической мембране обнаружен ряд ионных каналов, характеризующийся высокой специфичностью; это обуславливает перемещение лишь одного вида ионов. Существуют натриевые, калиевые, кальциевые и хлорные каналы. Каждому из таких каналов свойственен селективный фильтр, способен пропускать ионы определённого типа. Проницаемость ионных каналов способна преобразовываться благодаря наличию определённых групп атомов в составе белков, формирующих канал – воротам. Конформационные изменения ворот «переключают» канал из открытой формы в закрытую форму; и наоборот. Способы регуляции состояния ворот отличаются в различных каналах. Какие-то открываются при изменении электрического потенциала мембраны, а некоторые открываются при помощи специфических химических веществ, выполняющих сигнальные функции. [3,5,9,12] 26 Рисунок 16. Структура ионного канала 27 3. Активный транспорт Активный транспорт веществ через биомембраны играет огромную роль в жизнедеятельности клетки. Образование разности концентраций, разности электрических потенциалов, давления, которые поддерживают жизненно важные процессы. Если говорить с точки зрения термодинамики, механизмы активного транспорта удерживают организм в состоянии неравновесия, поддерживает жизнь, потому что явление равновесия в данном случае равновесие – это смерть организма. Доказать существование переноса вещества через биомембраны путём активного транспорта веществ впервые удалось в опытах Усинга в 1949 году на примере переноса ионов натрия через кожу лягушки. [12] Рисунок 17. Схема опыта Усинга на коже лягушки Активный транспорт – процесс переноса вещества, происходящий из области с меньшим электрохимическим потенциалом в ту область, где его значение больше. Этот процесс, обязательно сопровождается возрастанием 30 причем ионы Nа+ активизируют фермент со стороны цитоплазмы, а ионы К+ из окружающего раствора. Специфическим ингибитором фермента является сердечный гликозид-суабаин. В мембранах митохондрий активна другая молекулярная система, обеспечивающая откачку ионов Н+ — фермент Н+- АТФаза. [23] Рисунок 20. Активный перенос ионов транспортными АТФазами: I- схема К+- Na+- насоса в клеточной плазматической мембране, II- схема Са2+- насоса в мембране саркоплазматического ретикулума, III- схема протонного насоса во внутренней мембране митохондрий АТФ-насосы являются трансмембранными белками – пермеаз. Эти белки могут проводить вещества по схеме унипорта (натрий), симпорта (сахароза, хлор, аминокислоты), антипорта (марганец, натрий и магний). Об этих типах переноса вещества говорилось ранее. Это системы вторичного активного транспорта, переносящие вещества из мест их низкой концентрации в область высокой без расхода энергии метаболизма клетки. (см. п. 2.2.3.) [6,29] Механизм работы АТФаз-насоса главным образом основан на конформационной перестройке белковой макромолекулы, в момент взаимодействия с переносимым ионом. [4,20] 31 Рисунок 21. Схема изменений конформации АТФ-азы при транспорте ионов. Рассмотрим основные этапы такого сложного ферментативного процесса. Что касается К+-Nа+-АТФазы (дадим ей обозначение Е) различают 7 этапов переноса ионов, сопряженных с гидролизом АТФ. Обозначения Е1 и Е2 соответствуют расположению активного центра фермента на внутренней и внешней стороне мембраны;, P– неорганический фосфат, * активный комплекс: Рисунок 22. Схема процессов механизма работы К+-Nа+-АТФазы 32 Этапы работы К+-Nа+-АТФазы: 1) Образование комплекса фермента с АТФ на внутренней стороне мембраны 2) связывание комплексом 3 ионов Nа+ 3) фосфорилирование фермента с образованием АДФ 4) переворот фермента внутри мембраны 5) реакция ионного обмена Nа+ на К+ (на внешней поверхности мембраны) 6) обратный переворот ферментного комплекса с переносом ионов К+ внутрь клетки 7) возвращение фермента в исходное состояние с освобождением ионов К+ и неорганического фосфата [5,12,20] Перемещение 2 ионов К+ внутрь клетки и выброс 3 ионов Nа+ наружу приводит к переносу одного положительного иона из цитоплазмы в окружающую среду. В результате действия Na+-K+-АТФазы создаётся разность концентраций между цитозолем клетки и внеклеточной жидкостью. Поскольку перенос ионов неэквивалентен, то возникает разность электрических потенциалов. Так возникает электрохимический потенциал, формирующийся из энергии разности электрических потенциалов Δφ и энергии разности концентраций веществ ΔС по обе стороны мембраны. Таким образом, К+-Nа+- насос является электрогенным. [6,19] 35 градиента концентрации энергетически сопряжено с экзергоническим перемещением одной или нескольких молекул или ионов других типов по их электрохимическому градиенту концентрации. Симпортом процесс называется, когда второе вещество транспортируется в том же направлении, что и первое; соответственно, антипорт отличается противоположностью направлений. Примером симпорта служит перенос ионов натрия и глюкозы через мембрану клеток эпителия тонкой кишки. Механизмы типа антипорта и симпорта обобщают термином котранспортёры или копереносчики, тем самым уточняя их способность транспортировать два вида молекул разом. [5,10-13,19] Обязательно нужно отметить, что функционирование котранспортных систем возможно как при облегчённой диффузии, так и в процессе активного транспорта; во втором случае, это называется вторичным активным транспортом. [5] Рисунок 25. Системы переноса веществ при помощи транспортёров 36 4. Мультимолекулярный перенос Среди многообразия транспорта различных веществ в клетке имеется абсолютно уникальный механизм, предназначающийся для поглощения клеткой и выведения из неё высокомолекулярных соединений при помощи изменения формы биомембраны. Клеткам необходимо питаться и удалять продукты обмена, взаимодействовать с окружающей средой и быстро реагировать на её изменения. И для этого клетки постоянно модифицируют состав своей плазматической мембраны в ответ на внешние сигналы. Они используют сложную систему внутренних мембран для добавления или удаления расположенных на поверхности клетки, например, мембранных белков – рецепторов, ионных каналов, а также переносчиков. [13] Транспорт веществ, сопровождающийся изменением архитектуры мембраны и формированием мембранных пузырьков — везикул, называется везикулярным транспортом. Существует два способа такого мультимолекулярного переноса: эндоцитоз и экзоцитоз. 4.1. Эндоцитоз Эндоцитоз происходит путём поглощения веществ клеткой, при котором поглощаемое вещество окружается небольшим участком плазматической мембраны. Сначала плазматическая мембрана постепенно изгибается, а затем «отшнуровывается», формируя эндоцитозный пузырёк, внутри которого находится поглощенное вещество или частица. Это в свою очередь способствует образованию везикулы. Различают три типа эндоцитоза: фагоцитоз, пиноцитоз и рецепторно-опосредованный эндоцитоз. 37 4.1.1. Фагоцитоз Фагоцитоз (с греч. «фагос» — пожиратель; «цитос» — клетка) — процесс захвата клеточной поверхностью и поглощения клеткой твердых частиц. В этом случае образуются крупные пузырьки, называемые фагосомами диаметром более 250 нм. Фагоцитоз часто встречаемое явление в природе на всех ступенях развития животного мира, начиная с простейших. У целого ряда простейших, в особенности у амёб, фагоцитоз служит способом питания. Амёба захватывает пищу любым участком тела. Она обволакивает пищевой комочек и таким образом попадает в цитоплазму, где и переваривается. [31] Рисунок 26. Процесс фагоцитоза Фагоцитоз и внутриклеточное пищеварение играют огромную роль и у низших беспозвоночных животных. У высокоорганизованных животных, со специализированными органами пищеварения, путём фагоцитоза осуществляется фагоцитарная деятельность лейкоцитов и макрофагов, обеспечивающая защиту организма от попадающих в него патогенных микроорганизмов. Благодаря фагоцитарной деятельности лейкоцитов и 40 Рисунок 28. Процесс рецептор-опосредованного эндоцитоза 4.2. Экзоцитоз Процесс противоположный эндоцитозу называется экзоцитоз — перенос частиц и крупных соединений из клетки. Оба процесса протекают с поглощением энергии. При экзоцитозе транспортируемое вещество синтезируется в клетке, связывается мембраной в везикулы и экспортируется из клетки. Экзоцитозом из клетки выводятся специфические белки, нуклеиновые кислоты, сигнальные везикулы, выделяются непереваренные остатки из пищеварительных вакуолей и другое. Например, передача нервных импульсов происходит благодаря выделению передающим импульс нейроном химических посредников — медиаторов. Клетки эндокринных желез выделяют экзоцитозом гормоны, а пищеварительные железы — ферменты. [6, 31] 41 Рисунок 29. Процесс экзоцитоза Разновидностями экзоцитоза является секреция и экскреция. 4.2.1. Секреция Секреция — выведение из клетки водорастворимых соединений, которые используются или воздействуют на другие клетки организма. Секреция осуществляется и неспециализированными клетками, и клетками эндокринных желёз, слизистой желудочно-кишечного тракта, приспособленными для секреции производимых ими веществ (гормонов, нейромедиаторов, проферментов) исходя от потребностей организма. Секретируемые белки синтезируются на рибосомах, связанных с мембранами шероховатого эндоплазматического ретикулума. Затем белки переносятся к аппарату Гольджи, там модифицируются, концентрируются, сортируются, и упаковываются в пузырьки, которые отщепляются в цитозоль и в дальнейшем сливаются с плазматической мембраной вследствие чего содержимое пузырьков оказывается вне клетки. 42 4.2.2. Экскреция Экскреция — удаление из клетки веществ, непригодных для использования. Суть её заключается в том, что сначала выделяемые частицы оказываются в цитоплазматическом пузырьке, который затем сливается с плазматической мембраной. В пример можно привести удаление в ходе эритропоэза из ретикулоцитов сетчатой субстанции – агрегированные остатки органелл. [20, 29, 30] 4.3. Трансцитоз Существует феномен под названием трансцитоз, он имеет отношение к межклеточному транспорту веществ, к обмену макромолекул между клетками. Трансцитоз — ( от лат. «транс» – сквозь, через; «цитос» – клетка) процесс, сочетающий явления эндоцитоза (чаще пиноцитоза) и экзоцитоза одного и того же вещества в одной и той же клетке. Так происходит транспорт белковых гормонов из секреторных клеток в кровь через эндотелиальные клетки капилляров. При этом на обращенной к секреторным клеткам базальной стороне эндотелиоцитов образуется эндоцитозный пузырёк, который мигрирует к противоположной стороне, превращаясь в экзоцитозный. Таким образом, транспортируемый материал проходит через всю клетку, благодаря этому вещества могут поступать в определённые ткани, преодолевая тканевые барьеры. [30,31] 45 Список использованной литературы 1. [Электронный ресурс] Статья «Общие принципы строения клеток. Клеточная теория. Прокариоты и эукариоты» https://foxford.ru/wiki/biologiya/obschie-printsipy-stroeniya-kletok-kletochnaya- teoriya-pro-i-eukarioty 2. Кацнельсон З.С. «Клеточная теория в её историческом развитии». — Ленинград: МЕДГИЗ, 1963. — с. 344. 3. Мухина И.В. «Физиология и биофизика возбудимых систем». Учебно- методический материал по программе повышения квалификации «Хранение и обработка информации в биологических системах». Нижний Новгород, 2007. – 105 с. 4. Гершанович В. Н. «Биологические мембраны» М., 1973 – 424с. 5. Лекционная презентация «БМ пассивный транспорт 2020» https://psv4.userapi.com/c856428/u148020018/docs/d15/838da74bafce/BM_passi vny_transport_2020.ppt 6. Альбертс Б., Брей Д., Льюис Дж. и др. «Молекулярная биология клетки». 3 т. М., Мир, 1994 г.- 521с. 7. Hodgkin AL, Horowicz P. «Effects of K and Cl on the membrane potential of isolated muscle fibres» J.Physiol 1957 Jun 18;137(1):30р. 8. Рубин А.Б. Биофизика. М.: Высш. шк., 1987.-464с. 9. Огурцов А.Н. Биологические мембраны : учеб. пособие / Харьков : НТУ «ХПИ», 2012. – 368 с. 10. Robert B. Gennis «Biomembranes. Molecular structure and function». — 1-st publ. — М.: World, 1997. — ISBN 5-03-002419-0. – 34р. 11. Лайтфут Э. Явления переноса в живых системах. М.: Мир, 1977- 520 с. 12. Антонов В. Ф. «Биофизика мембран»: Соросовский образовательный журнал №6 , 1997г – 20с. 13. Котык А., Яначек К. Мембранный транспорт. М.: Мир, 1980 – 341 с. 46 14. Lakna Panawala «Difference between active and passive transport» May 2017- 10p. 15. William Stillwell «Membrane transport» Published 2016- 456 p. 16. Захаров В. Б. Биология. Профильный уровень. 10 класс: учеб. Для общеобразоват. учреждений / В. Б.Захаров, С. Г. Мамонтов, Н.И. Сонин.– М. : Дрофа, 2010. – 352 с. 17. Каменский А. А. Общая биология. 10 – 11 класс: учеб. для общеобразоват. учреждений / А. А. Каменский. Е. А. Криксунов, В. В. Пасечник. – М. : Дрофа, 2013. – 367 с. 18. Кузнецов С.Л., Мушкамбаров Н.Н. Гистология, цитология и эмбриология: Ученик. – 2-е изд., испр.и доп. – М.: ООО «Издательство «Медицинское информационное агенство», 2012. – 640с. 19. Волькенштейн М. В. Биофизика.- Спб: Лань, 2012- 608с. 20. Садовниченко Ю.А., Мясоедов В.В. Клеточные мембраны. Транспорт веществ через плазмалемму: Метод. реком. для самост. внеауд. работы студ. — Харьков: ХНМУ, 2015.-15 с. 21. Королев В. А., Кутя С. А., Сатаева Т. П. «Биология». Учебник для вузов. 2015 год. — 470 с. 22. Ташмухамедов Б. А., Гагельганс А. И., Активный транспорт ионов через биологические мембраны, Таш., 1973- 270 с. 23. [Электронный ресурс] Учебные материалы «Физические вопросы строения и функционирования биологических мембран» https://works.doklad.ru/view/- pWbJkAgenY/3.html 24. Seydel J.K., Wiese M. Drug-Membrane Interactions: Analysis, Modeling. — Weinheim: Wiley-VCH Verlag GmbH&Co. KGaA, 2002. — 362 p. 25. Ченцов Ю.С. Цитология: Уч. для вузов. — М.: Мед. информ. агентство, 2010. — 368 с. 26. Авдеева Л.В., Алейникова Т.Л., Андрианова Л.Е. : Биохимия/ Учебник; Под ред. Е.С. Северин. — М.: ГЭОТАР-МЕД, 2015. – 768 c. 47 27. Коваленко Л.В., Биохимические основы химии биологически активных веществ: учебное пособие. — М.: “Лаборатория знаний”, 2012. —228 с. 28. Плакунов, В.К. Основы динамической биохимии: учебное пособие — М. : Логос, 2010 – 216с. 29. Геннис Р. Биомембраны: Молекулярная структура и функции. — М.: Мир, 1997. — 624 с. 30. Заварзин А. А. Биология клетки: общая цитология / А. А. Заварзин, А. Д. Харазова. Изд-во СПбГУ, 1992. – 320 с. 31. Глебов Р. Н. Биохимия мембран. Эндоцитоз и экзоцитоз [Текст]. – М. : Высшая школа, 1997. – 95 с

Структура механизма выявления аквапоринов для транспортной селективности

Биохимики не очень-то привыкли видеть свои работы в популярной прессе, за исключением ежегодного освещения Нобелевской премии по химии. В этом году Родерик Маккиннон получил признание за разработку атомной структуры ионного канала, а Питер Агре – за открытие, что основной белок, обнаруженный в красных кровяных тельцах, функционирует в первую очередь как водный канал. Затем Агре основал группу связанных каналов, которые назвал «аквапорины».«Канальные белки имеют водные поры, которые пересекают клеточную мембрану и регулируют поток молекул в клетки и из них. Вода пассивно проходит через аквапорины путем осмоса, переходя от низких к высоким концентрациям растворенных веществ. Определение структуры этих каналов предоставило платформу для изучения лежащих в основе молекулярных механизмов, которые позволяют белкам функционировать как фильтры и поддерживать осмотическое равновесие. Роберт Страуд и его коллеги недавно решили атомную структуру аквапорина (GlpF) и теперь решили структуру другого водного канала из Escherichia coli , называемого аквапорином Z, который избирательно проводит только воду с высокими скоростями.

Аквапорины образуют большое разнообразное семейство белков и были обнаружены в бактериях, растениях и животных. В протеоме человека 11 членов семьи. Менее десяти лет назад ученые обнаружили ген аквапорина Z ( aqpZ ) в E. coli , указывая на роль белка в регуляции транспорта воды в этом прокариоте. Рентгеновские структуры высокого разрешения рекомбинантного акваглицеропорин-глицерин-фасилитатора (GlpF) – канального белка, который транспортирует глицерин и воду в E.coli – определенная группой Страуда в 2000 г. и бычий аквапорин 1 (AQP1) из красных кровяных телец, определенная годом позже, показали, как эти аквапорины регулируют их перенос и селективность. Белок канала Z аквапорин в E. coli может выдерживать поток воды со скоростью, в шесть раз превышающей скорость GlpF, что делает его основным объектом для изучения селективности водного канала с высокой проводимостью. И поскольку два основных класса аквапоринов встречаются в E. coli – что означает, что они находятся в одной и той же клеточной среде – и оба экспрессируются рекомбинантно, возможности для сравнительного структурного и функционального анализа в сочетании с сайт-направленным мутагенезом, обещают предоставить ценную информацию о молекулярных основах избирательности функционально различных аквапоринов.

После изготовления и выращивания рекомбинантной формы AqpZ в E. coli Дэвид Сэвидж из группы Страуд извлек белки из бактериальных колоний, затем очистил и сконцентрировал их. Белки были кристаллизованы, захватив пять молекул воды внутри, а затем проанализированы с помощью современных методов дифракции рентгеновских лучей с высоким разрешением. Исследователи сообщают, что архитектура аквапорина Z типична для аквапоринов: спираль из восьми атомов кислорода обеспечивает участки связывания воды внутри канала, а боковые цепи аминокислот определяют размер и химический состав канала.Наружная мембрана и цитоплазматические концы канала шире, чем внутренняя, которая длинная и узкая. Эта структура подтверждает, что селективность аквапоринов частично возникает из-за создания физического барьера: небольшие молекулы, такие как вода, могут легко проходить, а более крупные просто не подходят. А стратегическое расположение аминокислотных остатков с гидрофильными или гидрофобными свойствами вдоль канала помогает контролировать приток молекул на основе их сродства к воде. Хотя кажется, что две аминокислотные цепи, расположенные в середине канала, также обеспечивают водонепроницаемую поверхность, Stroud et al.говорят, что они играют более интригующую роль. Отмечая, что молекулы воды занимают канал в одном ряду, ученые объясняют, что такая ориентация обычно облегчает случайный поток протонов (или ионов водорода), который был бы смертельным для клетки. По их словам, эта центральная пара аминокислот ограничивает поведение молекул воды в центре канала таким образом, что предотвращает «прыжки протонов», но при этом поддерживает течение воды.

Имея две структурные модели аквапоринов вплоть до атомного уровня у одного и того же вида, ученые теперь могут приступить к исследованию молекулярных механизмов, которые способствуют их селективности.Важность понимания этих широко распространенных канальных белков была подчеркнута Нобелевскими премиями в этом году. Водный транспорт имеет фундаментальное значение для жизни, и аквапорины встречаются по всему телу. Знание их структуры поможет раскрыть молекулярную механику их специализированных подвигов и обещает дать представление о широком спектре человеческих заболеваний.

Aquaporin – обзор | ScienceDirect Topics

2.2.4 Концепция направленных водных каналов

Концепция направленных водных каналов связана с открытием структуры белков аквапоринов, сосуществующих с фосфолипидным бислоем, за что в 2003 году были отмечены лауреаты Нобелевской премии.Размер канала в форме песочных часов в самом узком месте составляет 0,30 нм [96–98], поэтому молекулы воды (0,28 нм) могут проходить через эти белковые каналы избирательно, а другие молекулы или ионы – нет. В качестве применения белки аквапорины были включены в барьерный слой мембраны, которая показывала в 80–1000 раз больший поток воды, чем обычные мембраны [99]. Водные каналы также могут быть обнаружены в выровненных мембранах на основе углеродных нанотрубок, где внутренний диаметр нанотрубки 2 нм может быть использован для избавления от загрязняющих веществ из воды с вдвое более высоким потоком, чем у коммерчески доступных мембран [100].Другие материалы, содержащие нанопористую структуру, такие как жидкие кристаллы с определенной фазой [101], нанолисты оксида графена [102], цеолиты [103] и синтезированные трубчатые молекулы [104], также предоставляют различные варианты интеграции направленных водных каналов с барьерным слоем. мембраны.

К сожалению, все вышеупомянутые методы имеют большие проблемы для практического применения, учитывая технологичность, надежность и стоимость изготовления. Например, плотность направленных водных каналов из белка аквапорина, встроенного в барьерный слой мембраны, была очень ограничена, что значительно снижает водопроницаемость и долговечность мембраны.Кроме того, углеродные нанотрубки должны быть выращены in situ на подложке с последующим выравниванием и соединением вместе, чтобы подготовить мембрану, что должно резко увеличить стоимость изготовления и риск возникновения дефектов. Кроме того, мембрана на основе цеолитов с извилистой пористой структурой повышает гидравлическое сопротивление; в результате тариф на водный транспорт будет увеличен ограниченно. В частности, когда оксид графена использовался для приготовления барьерного слоя мембраны для процесса обработки воды, требовалась дополнительная иммобилизация, и, следовательно, стоимость изготовления неизбежно возрастет. Более того, условия образования конкретной жидкокристаллической фазы являются критическими и их трудно масштабировать. Наконец, трубчатые молекулы с водными каналами, синтезированные в несколько этапов, экономически эффективны для практического производства. Следовательно, ожидается, что в барьерном слое RO ​​/ FO мембран будут легко и широко создаваться настраиваемые водные каналы, которые решают все вышеупомянутые проблемы [105,106].

Наша исследовательская группа расширила концепцию направленных водных каналов и продемонстрировала прорыв в области высокопоточных нановолоконных мембран.Были изготовлены мембраны TFNC с нанокомпозитным барьерным слоем, в котором барьерный слой был интегрирован с нановолоконными каркасами и сшитой полимерной матрицей. Как упоминалось ранее, электропряденые нановолокна могут быть встроены в полимерную матрицу и образовывать интегрированный верхний барьерный слой мембраны, где волокно окружено полимерными цепями [69,77,107]. Направленные водные каналы естественным образом образуются за счет разделения фаз между нановолоконным каркасом и полимерной матрицей, где промежуток между двумя фазами может использоваться в качестве каналов для разделения воды и других молекул загрязняющих веществ на основе механизма исключения размера [78,106]. Структура мембраны TFNC на основе трехслойной структуры с верхним нанокомпозитным слоем, состоящим из направленных водных каналов, показана на рис. 8.

Рис. 8. Типичная структура мембраны TFNC, где направленные водные каналы образованы электропрядеными нановолокнами и полимером. матрица в барьерном слое.

Перепечатано из Ref. [78], Copyright (2014), с разрешения Elsevier и перепечатано с разрешения (ACS Macro Lett., 2012, 1, 723–726.). Авторское право (2012) Американское химическое общество.

Круговая диаграмма на рис. 8 схематически иллюстрирует формирование направленных водных каналов в барьерном слое мембраны TFNC с типичной трехуровневой структурой. На диаграмме (часть с увеличением) нановолокна целлюлозы (желтые) работают как одна непрерывная фаза, образуя трехмерный каркас, а полимерная матрица (розовая), окружающая каркас, работает как другая непрерывная фаза. Между двумя фазами соединены полые цилиндрические зазоры, которые рассматриваются как направленные водные каналы (синий цвет). Следует отметить, что вода также может переноситься через молекулярные полости в полимерной матрице, как показано на рис. 8, однако направленные водные каналы являются предпочтительными вариантами из-за низкого гидравлического сопротивления. Преимущества направленных водных каналов перед молекулярными полостями полимерной матрицы очевидны: (1) направленные водные каналы теоретически могут быть образованы между любыми бинепрерывными фазами путем разделения фаз в барьерном слое, не ограничиваясь нановолокнами и полимерной матрицей; (2) размер направленных водных каналов можно гибко регулировать, регулируя разделение фаз между двумя фазами, поэтому можно получить разные типы мембран для множества применений; (3) свойства поверхности направленных водных каналов также можно изменить, просто украсив поверхность зазора, например, гидрофобными или гидрофильными, заряженными или нейтральными частицами; и (4) плотность направленных водных каналов может контролироваться путем включения нановолоконных каркасов в полимерную матрицу, которые могут не только обеспечивать направленные пути для транспортировки воды, но также улучшать механические свойства мембраны и сохранять высокую пористость, поэтому необходимо резко увеличить проницаемость.

Формирование направленных водных каналов в барьерном слое мембраны не ограничивается электропряденными нановолокнами, любые другие наноразмерные материалы, такие как углеродные нанотрубки [105,107] или нановолокна целлюлозы [106,108–110], также могут быть использованы для создания направленных водные каналы. Эта новая конструкция мембраны особенно подходит для приложений NF, RO и FO. Все мембраны, содержащие направленные водные каналы, могут иметь в 2–5 раз больший поток проницаемости, чем соответствующая мембрана без водных каналов [39].

Аквапорины

Аквапорины: водные каналы

Вода проникает через клеточные мембраны двумя путями: путем диффузии через липидный бислой и через водные каналы, называемые аквапоринами. Функциональная характеристика первого аквапорина была описана в 1992 году, но предполагалось, что водные каналы существовали задолго до того времени, потому что осмотическая проницаемость некоторых типов эпителиальных клеток была слишком большой, чтобы ее можно было объяснить простой диффузией через плазматическую мембрану.

Один канал аквапорина-1 человека способствует переносу воды со скоростью примерно 3 миллиарда молекул воды в секунду. Такой транспорт кажется двунаправленным в соответствии с преобладающим осмотическим градиентом.

Классические аквапорины переносят свободную от растворенных веществ воду через клеточные мембраны; они выглядят исключительно водными каналами и не проникают через мембраны к ионам или другим небольшим молекулам. Некоторые аквапорины – известные как акваглицеропорины – переносят воду, глицерин и несколько других небольших молекул.

Семья Аквапоринов

На сегодняшний день идентифицировано более 10 различных аквапоринов млекопитающих, и предполагается, что существуют дополнительные члены. Близкородственные белки водных каналов были выделены из растений, насекомых и бактерий. Аквапорин-1 из красных кровяных телец человека был открыт первым и, вероятно, изучен лучше всего.

Графики гидрофобности их аминокислотных последовательностей предсказывают, что аквапорины имеют шесть межмембранных сегментов, как показано на модели аквапорина-1 справа.

На основании исследований с аквапорином-1 выяснилось, что аквапорины существуют в плазматической мембране в виде гомотетрамеров. Каждый мономер аквапорина содержит две полупоры, которые складываются вместе, образуя водный канал.

Различные аквапорины имеют разные модели гликозилирования. В случае аквапорина-1 основная цепь пептида составляет примерно 28 кДа, а гликозилированные формы имеют массу от 40 до 60 кДа. Большинство аквапоринов имеют мотив фосфорилирования протеинкиназы А в одной из цитоплазматических петель, и предполагается, что дифференциальное фосфорилирование выполняет регуляторную функцию молекулы.

Паттерны экспрессии аквапоринов

Каждый из аквапоринов имеет по существу уникальный образец экспрессии в тканях и во время развития. Сводка этих атрибутов и некоторых важных потенциальных или известных функций представлена ​​в следующей таблице:

,00 ,00

Основные сайты экспрессии Комментарии
Аквапорин-0 Глаз: оптоволоконные клетки хрусталика Баланс жидкости в объективе
Аквапорин-1 Эритроциты Осмотическая защита
Почка: проксимальный каналец Концентрация мочи
Глаз: ресничный эпителий Производство водянистой влаги Мозг: хориодное сплетение Производство спинномозговой жидкости Легкое: клетки альвеолярного эпителия Состояние альвеолярной гидратации
Аквапорин-2 Почки: собирательные протоки Опосредует активность антидиуретического гормона
Аквапорин-3 * Почки: собирательные протоки Реабсорбция воды кровью
Трахея: эпителиальные клетки Секреция воды в трахею
Аквапорин-4 Почки: собирательные протоки Реабсорбция воды
Мозг: клетки эпендимы Баланс жидкости спинномозговой жидкости
Мозг: гипоталамус Функция осмосенсинга?
Легкое: эпителий бронхов Секреция бронхиальной жидкости
Аквапорин-5 Слюнные железы Производство слюны
Слезные железы Производство слезы
Аквапорин-6 Почки Очень низкая водопроницаемость; функция?
Аквапорин-7 * Жировые клетки Транспортирует глицерин из адипоцитов
Яички и сперма
Аквапорин-8 Яички, поджелудочная железа, печень и др.
Аквапорин-9 * Лейкоциты
* акваглицеропорин

Должно быть ясно, что аквапорины очень широко распространены, а также что разные аквапорины имеют разные функционально важные особенности.

Несколько интересных и важных особенностей опосредованного аквапорином транспорта воды проиллюстрированы на основных клетках, выстилающих собирающие протоки в почках. Вода, протекающая через эти протоки, может либо продолжаться и выводиться с мочой, либо реабсорбироваться через эпителий и обратно в кровь. Реабсорбция практически равна нулю, если эпителиальные клетки не видят антидиуретический гормон, который сильно стимулирует реабсорбцию воды. Клетки собирающих протоков экспрессируют не менее двух аквапоринов:

  • Аквапорин-2 синтезируется, но в отсутствие антидиуретического гормона находится в пуле мембранных везикул в цитоплазме. Связывание антидиуретического гормона с его рецептором в клетке не только стимулирует транскрипцию гена аквапорина-2, но и заставляет внутриклеточный пул аквапорина-2 встраиваться в апикальную мембрану. Теперь клетка может эффективно поглощать воду из просвета протока.
  • Аквапорин-3 конститутивно экспрессируется в базолатеральной мембране клетки. Когда вода заливает клетку через каналы аквапорина-2, она может быстро выйти из клетки через каналы аквапорина-3 и попасть в кровь.
Аквапорины и болезни

Учитывая важность переноса воды во множестве физиологических процессов, следует ожидать, что повреждения генов аквапоринов или приобретенная дисфункция аквапоринов могут вызывать или способствовать возникновению нескольких болезненных состояний. Поиск таких связей все еще находится на раннем этапе, но были выявлены два ярких примера заболеваний, вызванных дефицитом аквапоринов:

  • Мутации в гене аквапорина-2 вызывают у людей наследственный нефрогенный несахарный диабет.
  • У мышей, гомозиготных по инактивирующим мутациям в гене аквапорина-0, развивается врожденная катаракта.
  • Ожирение у взрослых развивается у мышей, гомозиготных по инактивирующим мутациям в гене аквапорина-7, предположительно из-за неэффективности транспортировки глицерина из запасов гидролизованных триглицеридов.

У небольшого числа людей был выявлен серьезный или полный дефицит аквапорина-1. Интересно, что они кажутся клинически незатронутыми, но не исследовались в условиях водного лишения.Мыши с целевыми делециями в аквапорине-1 также выглядят нормальными и здоровыми, если они не ограничены жидкостью, и в этом случае они становятся сильно гиперосмолярными.

Ссылки и обзоры
  • Borgnia M, Nielsen S, Engel A, Agre P: Клеточная и молекулярная биология водных каналов аквапоринов. Анну Рев Биохим 68: 425, 1999.
  • deGroot BL, Grubmuller H: Проникновение воды через биологические мембраны: механизм и динамика аквапорина-1 и GlpF. Наука 294: 2353, 2001.
  • Hibuse T, Proc Nat Acad Sci (США) 102: 10993, 2005.
  • King LS, Agre P: Патофизиология водных каналов аквапоринов. Annu Rev Physiol 58: 619, 1998.
  • .
  • Knepper MA, Inoue T: Регулирование движения водных каналов аквапорина-2 с помощью вазопрессина. Curr Opinion Cell Biol 9: 560, 1997.
  • .
  • Lee MD, King LS, Agre P: Семейство аквапоринов белков водных каналов в клинической медицине. Медицина 76: 141, 1997.
  • Preston GM, Carroll TP, Guggino WP Agre P: появление водных каналов в ооцитах Xenopus, экспрессирующих белок CHIP28 красных клеток.Science 256: 385, 1992.
  • Sasaki S, Ishibashi K, Marumo F: Аквапорин-2 и -3: представители двух подгрупп семейства аквапоринов, локализованных в собирательном канале почек. Annu Rev Physiol 60: 199, 1998.
  • .

Отправляйте комментарии [email protected]

Структура, динамика и функция аквапоринов

Структура, динамика и функция аквапоринов

Искусство водного транспорта в аквапоринах

Аквапорины – это мембранные водные каналы, которые играют критически важные роли в контроле содержания воды в клетках. Эти каналы широко распространены во всех царствах жизни, включая бактерии, растения и млекопитающие. Найдено более десяти различных аквапоринов. в организме человека, а также при некоторых заболеваниях, таких как врожденная катаракта и нефрогенный несахарный диабет, связаны с нарушением функции эти каналы. Они образуют тетрамеры в клеточной мембране и способствуют перенос воды и, в некоторых случаях, других мелких растворенных веществ через мембрана. Однако поры воды полностью непроницаемы для заряженных частиц, таких как протоны, замечательное свойство, которое имеет решающее значение для сохранение электрохимического потенциала мембраны, но парадоксально при в то же время, поскольку протоны обычно легко переносятся через молекулы воды.Результаты нашего моделирования теперь предоставили новые понимание механизма, лежащего в основе этого удивительного свойства. Воды молекулы, проходящие через канал, вынуждены электростатическим зарядом белка. заставляет перевернуть в центре канала (см. анимацию), тем самым нарушая альтернативное донорно-акцепторное устройство, которое необходим для транслокации протонов (полный текст читайте в нашем Наука бумага).

Функциональное значение специфической белковой архитектуры

В 2000 году лаборатории Страуда в UCSF удалось в решении первой структуры аквапорина с высоким разрешением с помощью рентгеновского кристаллография.Исследуемая структура была структурой E. coli фасилитатор захвата глицерина (GlpF), который представляет собой акваглицеропорин, , то есть , канал также проницаем для небольших линейных молекул сахара. например, глицерин. Наносекундное МД моделирование тетрамерного GlpF в гидратированный пластырь липидного бислоя ПОРЕ, характеризующий полный путь проводимости подложки в канале. Анализ водородной связи взаимодействие подложки с внутренней частью канала также впервые объяснил, почему эти каналы включены в их в архитектуре две характерные петли, в том числе энергетически невыгодные элементы вторичной структуры, которые сохраняются во всем аквапорине семья (Дженсен и другие., Структура, 2001).

Энергетика проникновения сахара

Затем мы исследовали энергетику транспорта. мероприятие, чтобы понять, какие барьеры необходимо преодолеть субстрату во время его прохождение по каналу. Чтобы описать бесплатные профиля энергии, мы рассчитали потенциал средней силы для событие полного проведения от траекторий, по которым движение глицерина через канал был ускорен за счет применения внешнего силы. Этот метод, известный как управляемый молекулярная динамика (SMD), позволяет наблюдать медленные события в доступном временном масштабе МД моделирования.Однако из-за к неравновесному характеру траекторий при анализе результаты сталкиваются с проблемой необратимой работы, которая должна быть со скидкой. Используя тождество Ярзинского, равенство свободную энергию и работу в неравновесных системах, мы могли бы полностью описать энергетику транспорта глицерина по каналу. В рассчитанный потенциал средней силы захватывает основные сайты связывания и барьеры в канале в тесном соответствии с результатами равновесное моделирование МД и кристаллическая структура.Более того, это демонстрирует выраженную асимметрию в своей форме, что позволяет предположить, что асимметричная структура белка может быть функционально важной для эффективное поглощение молекул питательных веществ из окружающей среды. (Дженсен и др. др., PNAS, 2002).

Что делает аквапорин глицериновым каналом

Аквапорины – очень удачное семейство мембранных белков, которые общеизвестно устойчивы к определению структуры. У нас есть теперь структуры с высоким разрешением нескольких AQP: GlpF, AQP1, AQP0 и AqpZ.Ожидается, что в ближайшее время появятся новые структуры. Наличие структура двух AQP из E. coli , один из которых представляет собой чистую воду канал (AqpZ), а другой – канал глицерина (GlpF) при условии нам с уникальной возможностью понять принципы избирательности используется природой в использовании двух генетически и структурно высокоразвитых гомологичные каналы для мембранной транспортировки различных материалов. Сравнение барьеров, рассчитанных для проводимости глицерина в эти два канала показали, что AqpZ использует стерические барьеры. затруднить прохождение глицерина.На самом деле поры в в целом уже, чем GlpF (см. рисунок ниже). Кажется, что природа обратился к очень простому механизму, а именно к настройке размера пор канала, чтобы сделать два белка из одного семейства проявляют различные свойства проводимости. Прочтите всю историю в Wang et al. др., СТРУКТУРА, 2005.

Создание каналов под давлением

Для прямого сравнения результатов МД симуляции с биохимическими измерениями проводимости мембранные водные каналы, в которых используются градиенты осмотического давления чтобы вызвать поток воды через мембрану, мы разработали новый методология моделирования МД.Применяя небольшие силы к воде молекул в объемной области (см. рисунок), гидростатическое давление градиент создается через мембрану. Градиент давления вызывает скорости проводимости, которые можно изучить с помощью МД-моделирования, обычно ограничивается несколькими наносекундами. Метод был применен в моделирование проникновения воды через GlpF, и в результате в линейной корреляции между приложенным давлением и потоком (Zhu et al., Биофиз. J., 2002).

Затвор водоводов

Проникновение воды через аквапорины – это пассивный процесс, который следует направлению осмотического давления через мембрану. Хотя многие аквапорины функционируют как всегда открытые каналы, подгруппа аквапоринов, особенно у растений, разработала сложный молекулярный механизм, с помощью которого канал может быть закрыт в ответ на суровые условия окружающей среды, при которых обмен воды может быть вредным для организма. организм. Примерами таких условий являются стресс от засухи и наводнение, которые запускают определенные клеточные сигналы (дефосфорилирование и изменение pH), которые приводят к закрытию канала. Недавно решенная структура аквапорина из шпината была смоделирована в различных условиях, чтобы исследовать молекулярный механизм вентиляции в этих мембранных каналах.Было обнаружено, что удлиненная цитоплазматическая петля у контролирующих способность аквапоринов физически перекрывает вход водной поры в закрытый канал и блокирует доступ молекул воды к поре. Смещение этой петли в ответ на фосфорилирование, как наблюдалось при моделировании, удаляет петлю от входа в цитоплазму поры. Кроме того, гидрофобная аминокислота, которая конформационно тесно связана с этой петлей, будет вытягиваться из канала в результате движения петли. Вместе эти молекулярные события приводят к открытию канала, проницаемого для молекул воды. Исследование появилось в Nature 2006.

Стробирование и ионная проводимость тетрамерной поры

AQP широко известны своим высокая водопроницаемость. Однако их участие в других клеточных функциях, включая проникновение малых молекул кроме воды, а также межклеточная связь была предложенный. Тетрамеризация – общая структурная особенность AQP.В тот факт, что каждый из четырех мономеров образует функционально независимую воду. поры, но требуют тетрамерной организации для функционирования, предполагает синергетический эффект олигомеризации и, таким образом, анализ потенциальной роли центральной поры в AQP. An интересным предположением является возможное вовлечение центральной поры в ионной проводимости при активации цГМФ. Используя МД моделирования встроенных в мембрану моделей AQP1, мы имеем исследовали это свойство AQP1, чтобы определить, как и под чем условия конформации и гидратации, центральная пора может проводить ионы и как регулируется проводимость. Один из цитоплазматических петли, а именно петля D, богатая аргинином, была предложена нашими моделирования, чтобы играть ключевую роль в cGMP-опосредованной активации центральная пора. Предполагаемая роль петли D была подтверждена. экспериментально разработанным мутант петли D, демонстрирующий полную потерю ионной проводимости (Yu et al., Структура, 2006 г.).

Молекулы газа перемещаются в ячейку

Каждое утро многие люди едут на работу, в то время как другие едут на велосипеде, автобус или метро. Точно так же различные биомолекулы в организме человека также достигают своих направления в разнообразных манерах.Например, чтобы пересечь клеточную мембрану, небольшие молекулы гидрофобного газа диффундируют через липид. двухслойный, а молекулы воды проходят через аквапорины (AQP). Интересно, что точно так же, как на работу можно добраться и на автобусе, и на вождения, недавно было обнаружено, что некоторые молекулы газа могут иметь больше чем один способ пересечь мембрану, т. е. помимо диффузии через липиды, кислород и углекислый газ также могут проходить через AQP. Однако пути, по которым проходят эти газовые молекулы, оставались неуловимыми.Используя молекулярную динамику, выполненную с NAMD, мы исследовали газ проницаемость AQP1 с два дополнительных метода (явное моделирование газовой диффузии и неявный лиганд выборка). Результаты моделирования показывают, что в то время как четыре мономерные поры AQP1 функционируют как водные каналы, центральная пора AQP1 может служить путем для молекул газа пересекают мембрану (Wang et al., Journal of Structural Biology, 2007).

Полоса молекулярных препятствий

Биологические клетки защищают свое внутреннее пространство через клеточные мембраны, но при этом зависят от импорта питательных веществ.Они развились для этого импорта быстрых каналов проведения, которые включают надежные контрольно-пропускные пункты, различающие желательные и нежелательные соединения. КПП представляет собой настоящую полосу препятствий, соединения могут быстро проходить. Понять дизайн канала сложно из-за отсутствия подробных экспериментальных данные о динамике питательных веществ. В настоящее время наиболее подробная информация поступает из просмотра динамики канала. вычислительно, начиная со статических кристаллографических структур.В недавнем исследовании изучалось, как глицерины, небольшие молекулы питательных веществ, необходимые некоторым бактериям, проходят через контрольные точки, реализованные через глицериновый канал GlpF. GlpF предоставляет четыре параллельных канала, мониторинг которых осуществлялся с помощью вычислений с использованием NAMD и нового алгоритма, который исследует энергетику канала достаточно быстро, чтобы быть методологически осуществимым на современных компьютерах. Результаты показывают, как физические характеристики глицерина, их способность образовывать так называемые водородные связи, их электрические дипольные моменты, их диффузионная подвижность и их внутренняя гибкость исследуются вдоль канала (Henin et al., Биофизический журнал, в печати).



Публикации

База данных публикаций Диффузия глицерина через Escherichia coli акваглицеропорин GlpF. Жером Энен, Эмад Тайхоршид, Клаус Шультен и Кристоф Чипо. Биофизический журнал , 94: 832-839, 2008. Исследование газопроницаемости клеточных мембран и мембранных каналов с помощью молекулярной динамики. Йи Ван, Хорди Коэн, Вальтер Ф. Борон, Клаус Шультен и Эмад Тайхоршид. Журнал структурной биологии , 157: 534-544, 2007.Механизм стробирования и ионная проводимость возможной тетрамерной поры в Аквапорине-1. Джин Ю, Андреа Дж. Йул, Клаус Шультен и Эмад Тайхоршид. Структура , 14: 1411-1423, 2006. Структурный механизм аквапоринации растений. С. Торнрот-Хорсфилд, Ю. Ван, К. Хедфальк, У. Йохансон, М. Карлссон, Э. Тайхоршид, Р. Нойц и П. Челлбом. Nature , 439: 688-694, 2006. Что делает аквапорин глицериновым каналом: сравнительное исследование AqpZ и GlpF. Йи Ван, Клаус Шультен и Эмад Тайхоршид. Структура , 13: 1107-1118, 2005. Кинетическая теория и моделирование одноканального водного транспорта. Эмад Тайхоршид, Фангцян Чжу и Клаус Шультен. В С. Ип, редактор, Справочник по моделированию материалов, Vol. I: Методы и модели , стр. 1797-1822. Спрингер, Нидерланды, 2005 г. К пониманию мембранных каналов. Эмад Тайхоршид, Хорди Коэн, Алексей Аксиментьев, Маркос Сотомайор и Клаус Шультен. Борис Мартинац и Анджей Кубальский, редакторы, Бактериальные ионные каналы и их эукариотические гомологи , стр.153-190. ASM Press, Вашингтон, округ Колумбия, 2005 г. Коллективная диффузионная модель проникновения воды через микроскопические каналы. Фанцян Чжу, Эмад Тайхоршид и Клаус Шультен. Physical Review Letters , 93: 224501, 2004. (4 страницы). Вычислительные исследования мембранных каналов. Бенуа Ру и Клаус Шультен. Структура , 12: 1343-1351, 2004.

Молекулярные основы блокировки протонов в аквапоринах. Нилмадхаб Чакрабарти, Эмад Тайхоршид, Бено Ру и Ргис Помс. Структура , 12: 65-74, 2004.

База данных публикаций Механизм исключения протонов в аквапориновых каналах. Боаз Илан, Эмад Тайхоршид, Клаус Шультен и Грегори А. Вот. БЕЛКИ: структура, функция и биоинформатика , 55: 223-228, 2004. Теория и моделирование проникновения воды в аквапорин-1. Фанцян Чжу, Эмад Тайхоршид и Клаус Шультен. Биофизический журнал , 86: 50-57, 2004. Электростатическая настройка проницаемости и селективности в водных каналах аквапоринов. Morten Ø. Йенсен, Эмад Тайхоршид и Клаус Шультен. Биофизический журнал , 85: 2884-2899, 2003. Вода и протонная проводимость через углеродные нанотрубки как модели биологических каналов. Фанцян Чжу и Клаус Шультен. Биофизический журнал , 85: 236-244, 2003. Глицериновая проводимость и физическая асимметрия фасилитатора глицерина Escherichia coli GlpF. Дею Лу, Пол Грейсон и Клаус Шультен. Биофизический журнал , 85: 2977-2987, 2003. Механизмы селективности каналов и ферментов изучены с помощью интерактивной молекулярной динамики. Пол Грейсон, Эмад Тайхоршид и Клаус Шультен. Биофизический журнал , 85: 36-48, 2003. Контроль селективности семейства водных каналов аквапоринов с помощью глобальной ориентационной настройки. Эмад Тайхоршид, Питер Ноллерт, Мортен О. Йенсен, Ларри Дж. У. Мирке, Джозеф О’Коннелл, Роберт М. Страуд и Клаус Шультен. Наука , 296: 525-530, 2002. Энергетика проведения глицерина через акваглицеропорин GlpF. Мортен О. Йенсен, Санхюн Парк, Эмад Тайхоршид и Клаус Шультен. Proceedings of the National Academy of Sciences, USA , 99: 6731-6736, 2002. Транспорт воды под давлением в мембранных каналах изучается методом молекулярной динамики. Фанцян Чжу, Эмад Тайхоршид и Клаус Шультен. Биофизический журнал , 83: 154-160, 2002. Механизм проведения глицерина в акваглицеропоринах. Morten Ø. Йенсен, Эмад Тайхоршид и Клаус Шультен. Структура , 9: 1083-1093, 2001. Молекулярно-динамическое исследование водного канала аквапорина-1 в липидном бислое.Фанцян Чжу, Эмад Тайхоршид и Клаус Шультен. FEBS Letters , 504: 212-218, 2001.

Последнее обновление: 15 октября 2006 г., автор – Эмад Тайхоршид

молекулярных механизмов проводимости и селективности в водных каналах аквапоринов | Журнал питания

Абстрактные

Аквапорины (AQP) – это семейство мембранных каналов, которые в первую очередь отвечают за проведение воды через клеточные мембраны. Доступность большого количества структурных данных с высоким разрешением наряду с многочисленными исследованиями моделирования в атомном масштабе привело к беспрецедентному уровню понимания механизма функционирования и селективности AQP.В этой статье, после обобщения основных моментов структурно-функциональных исследований AQP, мы расскажем о некоторых из наших недавних крупномасштабных моделей молекулярной динамики, исследующих механизмы проникновения различных веществ через чистые липидные бислои и через множественные пути, обеспечиваемые тетрамерными структурами. разных AQP. Сравнение результатов, полученных для структурно высокогомологичных, но функционально различных AQP, позволило нам идентифицировать новые механизмы стробирования и селективности этих каналов и конструировать мутанты с экспериментально подтвержденными измененными свойствами.В соответствующих случаях особое внимание будет уделено конкретным ароматическим аминокислотам и их участию в различных функциональных аспектах AQP.

Аквапорины: специализированные водные каналы

Транспортировка материалов через биологические мембраны – фундаментальный процесс во всех живых клетках. Небольшие незаряженные молекулы, такие как молекулы спиртов и газов, могут легко проходить через липидные бислои. Заряженные и полярные молекулы, однако, требуют специальных путей для пересечения клеточной мембраны, поскольку гидрофобные хвосты липидных молекул создают значительный энергетический барьер против их диффузии.Мембранные каналы обеспечивают такие пути для селективного обмена водорастворимых материалов, например вода, ионы и другие питательные вещества через мембрану. Три основных функциональных характеристики мембранных каналов, которые обеспечиваются определенным расположением аминокислот в их структуре, – это проницаемость, селективность и гейтинг. Последние разработки в экспериментальной структурной биологии и методологиях компьютерного моделирования продвинули наше понимание механизмов и основ этих функциональных аспектов в мембранных каналах при атомном разрешении.

Вода составляет ∼70% массы большинства живых организмов. Регулирование потока воды через клеточные мембраны имеет решающее значение для поддержания надлежащего баланса жидкости внутри клетки и в различных анатомических отделах. Проникновение воды через клеточные мембраны облегчается семейством мембранных каналов, называемых аквапоринами (AQP) (1–4). Эти избирательные каналы присутствуют во всех формах жизни, включая млекопитающих, амфибий, насекомых, растений и бактерий (2–4). У человека 13 различных AQP (AQP0 – AQP12) были охарактеризованы в различных органах, например.г. почки, глаза и мозг.

Хотя в целом известно, что он обеспечивает высокую трансмембранную проницаемость для воды (5,6), также сообщалось об участии AQP во множестве других клеточных процессов (3,7–9), например проницаемость малых молекул, отличных от воды (10), газовая проводимость (11–14) и даже межклеточная коммуникация (15). Физиологическое значение AQP отражается во многих распространенных патофизиологических ситуациях, связанных с их отсутствием и / или нарушением функции (2, 3, 8, 9, 16).Исследования на мышах с нокаутом показали, что активный транспорт жидкости в проксимальных канальцах и слюнных железах серьезно нарушен делецией AQP (17). Нарушение функций AQP0 и AQP2 напрямую связано с катарактой и несахарным диабетом соответственно (2,3,16,18). Недавние исследования AQP4, преобладающего AQP в центральной нервной системе, связали его потерю из периваскулярных мембран с ишемическим повреждением головного мозга (19,20). Фармакологическая модуляция функции AQP4 может обеспечить новую терапевтическую стратегию при расстройствах центральной нервной системы (21). Другие заболевания, связанные с AQP, включают синдром Шегрена и нарушение слуха (2,16,22).

AQP представляет собой богатейшее семейство мембранных каналов с точки зрения обилия структурных данных с высоким разрешением. Решены трехмерные кристаллографические структуры нескольких членов семейства. Структуры 2 бактериальных AQP [GlpF, глицериновый канал (23,24) и AqpZ (25), ортодоксальный водный канал] и 5 AQP млекопитающих [человеческий AQP1 (26), бычий AQP1 (27), крысиный AQP4 (28). ), а также AQP0 крупного рогатого скота и овцы при 2 различных условиях pH (29–31)] доступны с полным атомным разрешением.Совсем недавно были описаны две новые структуры AQP: структура AqpM, архейный канал H 2 S (32) и структуры растения AQP (PIP2 шпината) как в закрытом, так и в открытом состоянии (33). ). Решенные структуры нескольких AQP с высоким разрешением указывают на консервативную архитектуру белка во всем семействе. Все члены этого семейства образуют гомотетрамеры в мембране (Fig. 1), в которых 4 функционально независимых поры обеспечивают высокоселективные, но эффективные пути проникновения воды через низкий диэлектрический барьер липидных бислоев.Другая пора, известная как центральная пора, образована между 4 мономерами.

РИСУНОК 1

Модель тетрамера AQP с заделанной мембраной. Мономеры AQP окрашены индивидуально. Головные группы и хвосты встраиваемого липидного бислоя показаны пурпурным и желтым цветом соответственно. Водные отсеки на 2 сторонах мембраны показаны в диффузном представлении для контраста трансмембранных компонентов. Молекулы воды пересекают мембрану через водные поры, образованные внутри каждого мономера AQP в строгой конфигурации с одним файлом.Проницаемость воды в каждом мономере AQP, по-видимому, не зависит от других мономеров. Рисунок сделан с использованием снимка, взятого из МД-моделирования GlpF (24), и представляет собой типичную систему моделирования, используемую в вычислительных исследованиях, представленных в статье.

РИСУНОК 1

Модель тетрамера AQP с заделанной мембраной. Мономеры AQP окрашены индивидуально. Головные группы и хвосты встраиваемого липидного бислоя показаны пурпурным и желтым цветом соответственно. Водные отсеки на 2 сторонах мембраны показаны в диффузном представлении для контраста трансмембранных компонентов.Молекулы воды пересекают мембрану через водные поры, образованные внутри каждого мономера AQP в строгой конфигурации с одним файлом. Проницаемость воды в каждом мономере AQP, по-видимому, не зависит от других мономеров. Рисунок сделан с использованием снимка, взятого из МД-моделирования GlpF (24), и представляет собой типичную систему моделирования, используемую в вычислительных исследованиях, представленных в статье.

Наличие структур AQP с высоким разрешением и их несложная биологическая функция, т.е.Действуя как пассивные поры для проникновения в небольшие субстраты, они идеально подходят для моделирования молекулярной динамики (МД). Фактически, ни одно другое семейство мембранных белков не изучалось так широко, как AQP. Вычислительные исследования внесли значительный вклад в наше текущее понимание механизма проникновения субстрата и селективности в этих каналах (24,33–46). Эти исследования предоставили подробные картины некоторых аспектов проницаемости субстрата и селективности AQP.Одним особенно интригующим свойством AQP является уникальное расположение молекул воды (рис.2), которое способствует их способности исключать протоны (47,48), позволяя воде проходить, – проблема, которая привлекла большое внимание теоретиков (24, 40,42,49–53).

РИСУНОК 2

Структура мономера AQP ( a , b : виды сбоку; c : вид сверху). Мономер показан на поверхности в a и в желтой карикатуре на b , c и заряженные остатки показаны красным (отрицательным) и синим (положительным) цветом, полярные остатки – зеленым, а неполярные гидрофобные остатки – белым. Молекулы воды образуют единый файл внутри канала с уникальной биполярной конфигурацией, которая не способствует передаче протонов через файл (24). Внутренняя часть канала в основном гидрофобна. Явно показаны ключевые водородсвязывающие остатки, выстилающие поры, а именно Arg в SF и 2 аспарагина из консервативных мотивов аспарагин-пролин-аланин (NPA).

РИСУНОК 2

Структура мономера AQP ( a , b : виды сбоку; c : вид сверху). Мономер показан на поверхности в a и в желтой карикатуре на b , c . В и заряженные остатки показаны красным (отрицательным) и синим (положительным) цветом, полярные остатки – зеленым, а неполярные гидрофобные остатки – белым. Молекулы воды образуют единый файл внутри канала с уникальной биполярной конфигурацией, которая не способствует передаче протонов через файл (24).Внутренняя часть канала в основном гидрофобна. Явно показаны ключевые водородсвязывающие остатки, выстилающие поры, а именно Arg в SF и 2 аспарагина из консервативных мотивов аспарагин-пролин-аланин (NPA).

Механизм проводимости воды и исключения протонов

Ранние исследования моделирования AQP были сосредоточены на структурной стабильности канала и исследовали механизм и динамику проникновения субстрата. Разрешение имеющихся рентгеновских структур оказалось очень важным при расчете точных скоростей проникновения воды в этих каналах.Моделирование AQP1 в мембране с использованием структуры канала с более низким разрешением (3,8 Å) показало, что конформация критических аминокислот, выстилающих пору, нестабильна и, таким образом, не смогла правильно описать скорость проникновения (34).

Проникновение воды через большую часть AQP происходит очень быстро и может наблюдаться в наносекундных временных масштабах в моделировании МД в условиях равновесия; например, множественные случаи проникновения молекул воды с одной стороны мембраны на другую наблюдались, например, на рис.g., AQP1 и GlpF в условиях равновесия (24,54). Размер поры в AQP недостаточен для размещения более одной молекулы воды в большинстве областей вдоль оси канала. Таким образом, вода проходит в конфигурации одного файла (рис. 2), в котором движение молекул воды сильно коррелировано (40). Конфигурация воды с одним файлом оказалась чрезвычайно важной в механизмах селективности, используемых в канале (24).

Хотя такое моделирование позволяет рассчитать равновесные свойства водных каналов, большинство экспериментальных результатов по проникновению воды через AQP было получено в условиях осмотического давления, т.е.е. неравновесные условия. Для моделирования канала в аналогичных условиях был разработан новый вычислительный метод (41,55). Этот метод использует преимущество приложения малых сил к объемным молекулам воды для создания градиента гидростатического давления через мембрану, таким образом изменяя химический потенциал воды на двух сторонах мембраны. В таких условиях наблюдается чистый поток воды через мембрану. Используя этот метод, можно легко изменить разницу давлений между двумя сторонами мембраны.Применяя различные градиенты давления, была рассчитана осмотическая проницаемость GlpF (55) и AQP1 (41), которая находится в хорошем согласии с экспериментальными значениями.

Моделирование моделей GlpF, насыщенных глицерином, как указано в кристаллической структуре (23), привело к качественному описанию пути субстрата (35). Более количественную картину события можно получить, пропустив глицерин через канал и рассчитав соответствующий профиль свободной энергии (36). Моделирование GlpF в мембране (рис.1) удалось смоделировать диффузионное проникновение воды через эти каналы, но также было уделено больше внимания механизму блокировки протонов в этих каналах и предложена уникальная конфигурация молекул воды (рис.2) в качестве нового механизма исключения протонов (24). Дальнейшие вычислительные исследования с использованием различных методологий позволили детально изучить предлагаемый механизм (40,42,49,51,56).

Мембранная вставка AQP

Как и другие мембранные белки, для правильного функционирования AQP необходимо встроить в клеточную мембрану.Структура белка свернутой мембраны, гидрофобные свойства его поверхности, а также расположение определенных ароматических остатков на поверхности белка имеют решающее значение для этого процесса. Обычно мембранный белок демонстрирует большую гидрофобную поверхность, образованную неполярными остатками, где белок взаимодействует с гидрофобным ядром липидного бислоя (см. Пример на фиг. 3). Интересно, что ароматические аминокислоты, особенно тирозин (Tyr) и триптофан (Trp), часто обнаруживаются на границе гидрофобного ядра и области головной группы липидных бислоев.Скорее всего, это связано с их химической гетерогенностью, а именно с их гидрофобными свойствами и способностью образовывать водородные связи, что делает их идеальными для межфазных областей, где остаток контактирует как с гидрофобной, так и с полярной средой (57–60).

РИСУНОК 3

Ароматические остатки и мембранная вставка AQP. Вверху: тетрамер акваглицеропорина (GlpF), изображенный на поверхности и окрашенный в зависимости от типа остатка (белый: неполярный; зеленый: полярный; синий: основной; красный: кислотный).Внизу: остатки Trp и Tyr, показанные красным цветом Ван-дер-Ваальса, образуют 2 кольца вокруг областей головной группы липидов. Вставка белка нарушает структуру мембраны, чтобы максимально увеличить перекрытие липидных хвостов с гидрофобной частью белка.

РИСУНОК 3

Ароматические остатки и мембранная вставка AQP. Вверху: тетрамер акваглицеропорина (GlpF), изображенный на поверхности и окрашенный в зависимости от типа остатка (белый: неполярный; зеленый: полярный; синий: основной; красный: кислотный).Внизу: остатки Trp и Tyr, показанные красным цветом Ван-дер-Ваальса, образуют 2 кольца вокруг областей головной группы липидов. Вставка белка нарушает структуру мембраны, чтобы максимально увеличить перекрытие липидных хвостов с гидрофобной частью белка.

На рисунке 3 показана встроенная в мембрану модель AQP, которая моделировалась в течение нескольких наносекунд (24). Хотя в начальной конфигурации моделирования липидные молекулы были размещены в очень упорядоченной форме вокруг белка, с течением времени моделирования порядок в значительной степени теряется.Молекулы липидов пытаются максимально увеличить перекрытие своих хвостов с гидрофобной поверхностью белка (показано белым на виде сверху на рис. 3), эффект известен как гидрофобное совпадение. Как показано в этом примере, мембранные белки могут сильно влиять на структуру липидного бислоя путем их вставки. Ближе к областям головной группы на 2 сторонах мембраны 2 кольца ароматических боковых цепей (Trp и Tyr) определяют границу между гидрофобным ядром и полярным внемембранным участком белка.Подобные закономерности ожидаются и для других мембранных белков.

Селективность подложки

Наряду с открытием новых функций для AQP и доступностью большего количества структур для членов семьи, мы начали понимать физические механизмы конкретных функций этих каналов. AQP делятся на 2 подсемейства: ортодоксальные AQP, которые проводят только воду, и акваглицеропорины, которые обладают дополнительной способностью проводить другие небольшие молекулы, такие как глицерин (61,62), мочевина (3), нитрат (63) и арсенит. (64).Хотя большинство проводимых молекул нейтральны, могут быть исключения, когда предполагается, что AQP проводит заряженные частицы, в частности ионы. Например, AQP6, AQP млекопитающих, может действовать как хлоридный канал (65,66). Также было показано, что AQP1 может быть активирован циклическим гуанозинмонофосфатом (цГМФ), чтобы проводить катионы неселективным образом (46,67). Учитывая очень похожую архитектуру и общую структуру AQP, очень интересно понять, какие тонкие различия в их аминокислотном составе и структуре ответственны за их различные свойства проводимости.

В Escherichia coli были охарактеризованы 2 различных AQP: AqpZ, канал чистой воды, и GlpF, акваглицеропорин, который проводит глицерин вместе с водой. Доступность структур высокого разрешения этих двух структурно высокогомологичных, но функционально различных AQP одного и того же вида предоставила нам уникальную возможность развить понимание структурной основы, лежащей в основе селективности субстрата в этих каналах (44). Несмотря на очень похожую структуру, проводящие свойства этих двух каналов сильно различаются.Различие объясняется различными структурными элементами, а именно размером поры и природой аминокислот, составляющих так называемый фильтр селективности (SF), то есть самое узкое место поры, расположенное очень близко к периплазматическому вестибюлю канала. (25,44,68).

Аминокислотный состав и структура SF GlpF и AqpZ сравниваются на рисунке 4. Как показано, ароматические аминокислоты являются основными составляющими SF. В случае глицеринового канала GlpF SF состоит из гидрофобного клина [Trp и фенилаланин (Phe)] с одной стороны и гидрофильной поверхности [аргинин (Arg)] с противоположной стороны.Гидрофобный клин, образованный ароматическими аминокислотами (консервативными в членах подсемейства акваглицеропоринов), обеспечивает жирное скольжение глицерина и других линейных молекул сахара, проводимых каналом, и, таким образом, может играть важную роль в селективности по глицерину (23). В AqpZ, как и в других традиционных AQP, SF имеет совсем другой состав, что приводит к повышенной полярности канала в этой области. Ароматические боковые цепи Trp и Phe в GlpF теперь заменены на Phe и гистидин, соответственно (рис.4). Глицериновые каналы представляют собой пример, в котором ароматические аминокислоты играют важную роль в определении как размера, так и полярности функционально критических областей в белке.

РИСУНОК 4

Сравнение радиусов каналов и SF глицерин-проводящего AQP (GlpF) и канала чистой воды (AqpZ) из E. coli . Слева: мономеры GlpF и AqpZ показаны на поверхности и окрашены в зависимости от типа остатка. Радиусы каналов GlpF и AqpZ, показанные желтыми и пурпурными сферами соответственно, были рассчитаны с помощью программы HOLE (81).Справа: SF GlpF (справа вверху) и AqpZ (справа внизу). GlpF имеет более крупные поры и более гидрофобный SF.

РИСУНОК 4

Сравнение радиусов каналов и SF глицерин-проводящего AQP (GlpF) и канала чистой воды (AqpZ) из E. coli . Слева: мономеры GlpF и AqpZ показаны на поверхности и окрашены в зависимости от типа остатка. Радиусы каналов GlpF и AqpZ, показанные желтыми и пурпурными сферами соответственно, были рассчитаны с помощью программы HOLE (81). Справа: SF GlpF (справа вверху) и AqpZ (справа внизу).GlpF имеет более крупные поры и более гидрофобный SF.

Чтобы исследовать, является ли SF единственным энергетическим барьером против проникновения глицерина в канал чистой воды, проникновение глицерина было индуцировано с помощью управляемого моделирования MD (69) через GlpF и AqpZ, и была рассчитана свободная энергия, связанная с событием, и по сравнению (36,44). Хотя AqpZ не является глицериновым каналом, искусственно индуцированный пассаж глицерина может быть достигнут в моделировании, из которого мы смогли идентифицировать барьеры, которые делают AqpZ непроницаемым для глицерина в нормальных условиях (44).Расчетный энергетический барьер против проникновения глицерина оказался примерно в 3 раза больше в AqpZ, чем в GlpF (36) в области SF, что явно соответствует известной проницаемости этих двух каналов.

Однако результаты показали, что высокий барьер против проникновения глицерина возник не только в SF-области AqpZ, которая, как полагают, является причиной основного структурного различия между AqpZ и GlpF, но и вдоль всего канала. В соответствии с энергетическими расчетами, расчет размера пор 2 AQP показал, что в целом поры AqpZ более узкие (рис.4) (44). Результаты показывают, что разница в селективности субстрата для AqpZ и GlpF может быть не просто следствием только тех остатков, которые непосредственно выстилают канал (44), то есть меньший размер пор вдоль всего канала AqpZ не может быть объяснен только вовлечением выстилки каналов. остатки (44). Чтобы преобразовать водный канал в глицериновый канал, необходимо идентифицировать удаленные остатки, которые не взаимодействуют напрямую с проникающим веществом, но тем не менее контролируют диаметр канала посредством смещения и наклона спиралей, образующих поры (44).

Закрытие водных пор и центральной поры

Считается, что большинство AQP работают как постоянно открытые водные каналы. Однако о закрытии водных пор сообщалось для большого количества AQP, в частности, но не ограничиваясь этим, растительный AQP (рис. 5). Очевидно, что регулирование водопроницаемости AQP имеет решающее значение для управления потоком воды в ячейку и из нее. Например, заводы реагируют на засуху или наводнение отключением почти всех своих AQP.Общие сигналы, с помощью которых закрываются поры воды, включают изменения pH окружающей среды и фосфорилирование (29,33,70,71). Гейтинг, опосредованный pH и фосфорилированием, также описан для AQP млекопитающих, таких как AQP0 (29,70) и AQP4 (72). Определение структуры AQP0 при 2 различных условиях pH было попыткой пролить свет на структурные элементы, участвующие в регулировании pH. Однако, поскольку эти две структуры оказались почти идентичными, механизм регулирования pH оказался более сложным, чем ожидалось (29,30).

РИСУНОК 5

Механизм закрытия водных пор в установке AQP. AQP шпината (SoPIP2; 1) запускается фосфорилированием определенного остатка (серин-115) посредством конформационного контроля 1 из петель цитоплазмы (петля D, показанная в двух различных конформациях красным и синим цветом соответственно). В замкнутом виде петля D (синяя) перекрывает вход водяной поры. Фосфорилирование серина-115 запускает смещение петли D из поры в новую конформацию (красный цвет), позволяя молекулам воды получить доступ к водной поре.

РИСУНОК 5

Механизм закрытия водных пор в установке AQP. AQP шпината (SoPIP2; 1) запускается фосфорилированием определенного остатка (серин-115) посредством конформационного контроля 1 из петель цитоплазмы (петля D, показанная в двух различных конформациях красным и синим цветом соответственно). В замкнутом виде петля D (синяя) перекрывает вход водяной поры. Фосфорилирование серина-115 запускает смещение петли D из поры в новую конформацию (красный цвет), позволяя молекулам воды получить доступ к водной поре.

Считается, что центральная пора AQP закрыта. Одна из наиболее спорных функций центральной поры – это ионная проводимость, которая может быть запущена только после того, как белок активируется повышенными уровнями цГМФ в клетке, подразумевая, что задействован стробирующий механизм. О ионной проводимости, активируемой нуклеотидами, сообщалось для AQP1 (67,73,74), и тот факт, что ионная проводимость и транспорт воды могут быть ингибированы фармакологически независимо друг от друга, предполагает, что вода и ионная проводимость имеют место через разные поры.Центральная (тетрамерная) пора (рис. 6) была предложена как ионный канал в AQP1 (67,73). Тетрамерная организация AQP действительно напоминает ионные каналы, такие как K + , и каналы, управляемые циклическими нуклеотидами.

РИСУНОК 6

Газовая и ионная проницаемость центральной поры в AQP. ( a ) Вид сверху тетрамера AQP1, встроенного в липидный бислой. Видны четыре мономерные поры (водные поры) и центральная пора, образованная в середине тетрамера.( b ) Кислород (желтый) может проходить через AQP1 через центральную пору, но молекулы воды остаются вне поры. ( c ) ЦГМФ-индуцированная ионная проницаемость центральной поры (см. Текст). Молекулы воды начинают гидратировать центральную пору в присутствии иона натрия (зеленый). В b , c показаны только 2 мономера AQP1. Также показаны остатки выстилки поры валин-52, лейцин-56, Phe-176 и лейцин-172.

РИСУНОК 6

Газовая и ионная проницаемость центральной поры в AQP.( a ) Вид сверху тетрамера AQP1, встроенного в липидный бислой. Видны четыре мономерные поры (водные поры) и центральная пора, образованная в середине тетрамера. ( b ) Кислород (желтый) может проходить через AQP1 через центральную пору, но молекулы воды остаются вне поры. ( c ) ЦГМФ-индуцированная ионная проницаемость центральной поры (см. Текст). Молекулы воды начинают гидратировать центральную пору в присутствии иона натрия (зеленый). В b , c показаны только 2 мономера AQP1.Также показаны остатки выстилки поры валин-52, лейцин-56, Phe-176 и лейцин-172.

Механизм опосредованного фосфорилированием закрытия водных пор в растении AQP был исследован в комбинированном экспериментальном и теоретическом исследовании (33). Была получена рентгеновская структура канала в его закрытой форме, которая использовалась для изучения конформационных изменений, вызванных фосфорилированием. В замкнутой (нефосфорилированной) форме 1 из цитоплазматических петель (петля D), которая на 4–5 остатков длиннее у растительного AQP по сравнению су млекопитающих, удерживается в своем закрывающем положении за счет Н-связей с N-концом белка (рис. 5). Результаты моделирования (33) показали, что при фосфорилировании соединение N-конца и петли D разрывается и последняя может подвергаться большим конформационным изменениям. Эти изменения, в свою очередь, привели к открытию водных пор посредством 2 дополнительных механизмов: 1 ) смещения петли D из цитоплазматического устья канала; и 2 ) удаление из поры гидрофобного остатка, выстилающего поры (33).

Мы также исследовали проникновение ионов через предполагаемую центральную пору, протягивая ион натрия через пору и удерживая ион в различных областях вдоль оси поры (46). Моделирование позволило нам определить основные препятствия на пути проникновения ионов через центральную пору. Анализировали конформационные изменения белка и / или гидратацию пор в ответ на присутствие иона. Наиболее заметными эффектами были значительная гидратация поры и большие конформационные изменения петли D (46).

Кроме того, влияние связывания цГМФ на белок изучали путем моделирования, в котором 4 молекулы цГМФ помещали на поверхность белка. Во время моделирования молекулы цГМФ установили множественные контакты с петлей D (46). Конформация этой гибкой петли сильно нарушалась цГМФ, в основном из-за сильных взаимодействий нуклеотида с богатой Arg областью петли. Отвод петель D 4 мономеров от центральной поры не только физически разблокировал вход в центральную пору, но также привел к конформационным изменениям кольца выстилки поры, гидрофобных остатков, которые образовывали ворота и блокировали доступ воды. (Инжир.6). Спираль, несущая эти гидрофобные остатки, была немедленно соединена с петлей D, и весьма вероятно, что конформационное соединение петли D и этой спирали было молекулярным механизмом обнаружения связывания цГМФ внутри центральной поры (46). Участие Arg в механизме стробирования было успешно подтверждено экспериментальными измерениями на двойных мутантных видах, у которых 2 из Arg были нокаутированы (46). Мутант показал водопроницаемость, очень похожую на проницаемость для воды дикого типа, в то время как его ионная проводимость была почти полностью отменена (46).Основываясь на результатах нашего моделирования, был предложен стробирующий механизм, в котором петля D играет критическую роль в контроле доступности центральной поры для воды и гидратированных ионов (46).

Поразительно сходство между стробирующим механизмом, предложенным для активации цГМФ центральной поры AQP1 (46) и индуцированным фосфорилированием закрытием водных пор в PIP2 шпината (33). В обоих случаях конформация одной и той же цитоплазматической петли (петли D) контролирует положение гидрофобных остатков, которые непосредственно выстилают пору и могут очень эффективно открывать или закрывать поры.

Газопроницаемость через AQP

AQP проводят O 2 и CO 2 через биологические мембраны (12–14,75–80). Из-за обычно высокой плотности AQP в клеточных мембранах есть серьезные подозрения о физиологическом значении проникновения газа через AQP. Чтобы пролить свет на механизм и путь газовой проводимости, проницаемость AQP1 млекопитающих для O 2 и CO 2 была исследована с использованием 2 дополнительных методик моделирования (80), примененных к обеим мембранно-встроенным моделям тетрамерного AQP1, а также к моделям чистого липидного бислоя. Моделирование показало, что центральная пора AQP1 может быть легко использована любой молекулой газа для проникновения в канал (рис. 6). Главный энергетический барьер идентифицируется только в периплазматическом вестибюле и, по-видимому, в основном связан с плотным кластером молекул воды, закрепленных в периплазматическом устье центральной поры специфическими остатками аспартата.

Мономерные водные поры AQP1 оказались менее проницаемыми для газа, чем центральная пора, вероятно, из-за сильных водородных связей между белком и молекулами воды внутри канала.Поры воды показывают очень низкую проницаемость для O 2 , но могут вносить вклад в общее проникновение CO 2 из-за его более гидрофильной природы. Хотя центральная пора AQP1 оказывается газопроницаемой, чистый бислой пальмитоилолеил-фосфатидилэтаноламина обеспечивает гораздо большую площадь поперечного сечения, таким образом демонстрируя гораздо более низкий энергетический барьер для проникновения CO 2 и O 2 .

Наше моделирование предполагает, что, помимо своей обычной роли водного канала, AQP1 может обеспечивать путь для небольших нейтральных газовых молекул через мембрану.Однако по сравнению с чистым двойным слоем пальмитоилолеил-фосфатидилэтаноламина с аналогичной площадью, AQP1 менее проницаем для газов как для CO 2 , так и для O 2 . Следовательно, прохождение газа через AQP1 может иметь физиологическое значение только в мембранах с низкой собственной газопроницаемостью или там, где большая часть площади поверхности мембраны занята AQP.

Мы обнаружили, что CO 2 и O 2 спонтанно попали в центральную пору AQP1 и наблюдали 1 событие полного проникновения для каждого типа молекулы газа.Мы обнаружили 8 молекул CO 2 и 5 O 2 внутри центральной поры AQP1, когда моделирование равновесия закончилось на 30 нс и 26 нс, соответственно (рис. 6). Наши результаты показывают, что гидрофобная центральная пора AQP1 действительно проницаема как для CO 2 , так и для O 2 . Наше моделирование диффузии газа дополнительно выявило событие полного проникновения каждого типа молекулы газа через центральную пору. По сравнению с хорошо изученными водными порами, центральная пора AQP плохо изучена, и давно остается вопрос, имеет ли она какое-либо физиологическое значение.Наше моделирование предполагает, что центральная пора AQP1 обеспечивает потенциальный путь проникновения газа и что этот путь может играть физиологическую роль либо в мембранах с низкой собственной проницаемостью для газа, либо когда большая часть мембраны занята AQP.

Селективность, проницаемость и механизмы стробирования – это 3 функциональных свойства, которые характеризуют канальные белки. Из-за обилия структурной информации и простоты своей основной функции AQP служили идеальными мембранными каналами для изучения взаимосвязи структура-функция.Большое количество структурно известных AQP, дополненных многочисленными вычислительными исследованиями, выполненными на различных членах семейства, обеспечили беспрецедентный уровень детализации механизмов проникновения, селективности и стробирования этих каналов. Несмотря на обилие структурной информации, доступной для AQP, мы только начали понимать структурные детерминанты и принципы проницаемости субстрата и селективности в этих каналах (25,44). До сих пор почти все исследования мутагенеза, направленные на взаимное преобразование водных и глицериновых каналов, потерпели неудачу, что указывает на то, что механизм субстратной селективности мономерных пор в AQP изучен плохо.Наши знания о функции центральной поры еще более скудны. В литературе имеется лишь несколько сообщений о причастности центральной поры к проводимости проникающих веществ, отличных от воды, при определенных обстоятельствах (67,73). Следовательно, очень важно и физиологически важно исследовать лежащую в основе селективность этих каналов для различных субстратов на атомном уровне.

Проникновение воды, глицерина, ионов и молекул газа через поры мономерной воды и центральную пору в AQP было успешно смоделировано с помощью моделирования методом МД.Эти исследования выявили механизмы селективности, которые нельзя было бы идентифицировать иначе. В будущих вычислительных исследованиях больше внимания будет уделено вопросу селективности, что может привести к созданию мутантов с измененными свойствами проницаемости и селективности.

В отличие от водных пор, роль центральной поры в AQP очень плохо изучена; Мономеры AQP действуют совершенно независимо, но почти всегда обнаруживаются в тетрамерах, и это свойство убедительно указывает на физиологическую роль центральной поры.Будущие биохимические анализы и вычислительные работы могут пролить больше света на неизвестную роль центральной поры в AQP. Имитационные исследования также внесли вклад в наше понимание механизмов закрытия водных пор и центральной поры в AQP.

Несмотря на важные успехи, предпринятые в экспериментальных и вычислительных исследованиях структуры AQP, они представляют собой молодую область исследований. Функция и физиологическая роль AQP во многих тканях и органах неясны. Необходимы дополнительные биологические исследования с применением более чувствительных и новых биохимических и биофизических анализов для определения многих аспектов функции этих каналов, и мы должны ожидать увидеть множество функций для AQP, помимо чистых невинных водных каналов.

Авторы выражают признательность за суперкомпьютерное время, предоставленное TeraGrid через гранты Комитета по распределению больших ресурсов MCA06N060 и MCA93S028.

Цитированная литература

1.

Preston

GM

,

Carroll

TP

,

Guggino

WB

,

Agre

P

.

Появление водных каналов в ооцитах Xenopus, экспрессирующих белок CHIP28 красных клеток

.

Наука.

1992

;

256

:

385

7

.2.

Agre

P

,

Bonhivers

M

,

Borgnia

MJ

.

Аквапорины, чертежи для сотовых водопроводов

.

J Biol Chem.

1998

;

273

:

14659

62

.3.

Borgnia

M

,

Nielsen

S

,

Engel

A

,

Agre

P

.

Клеточная и молекулярная биология водных каналов аквапоринов

.

Annu Rev Biochem.

1999

;

68

:

425

58

. 4.

Heymann

JB

,

Engel

A

.

Аквапорины: филогения, строение и физиология водных каналов

.

Новости Physiol Sci.

1999

;

14

:

187

93

.5.

Preston

GM

,

Agre

P

.

Выделение кДНК интегрального мембранного белка эритроцитов 28 кДа: член семейства древних каналов

.

Proc Natl Acad Sci USA.

1991

;

88

:

11110

4

.6.

Согласен

P

.

Водные каналы Aquaporin (Нобелевская лекция)

.

Angew Chem Int Ed Engl.

2004

;

43

:

4278

90

.7.

Hohmann

S

,

Nielsen

S

,

Agre

P

.

Аквапорины.

Сан-Диего

:

Academic Press

;

2001

.8.

Agre

P

,

Kozono

D

.

Водные каналы аквапоринов: молекулярные механизмы болезней человека

.

FEBS Lett.

2003

;

555

:

72

8

.9.

Agre

P

,

Nielsen

S

,

Ottersen

OP

.

На пути к молекулярному пониманию гомеостаза воды в головном мозге

.

Неврология.

2004

;

129

:

849

50

.10.

Agre

P

,

King

LS

,

Yasui

M

,

Guggino

WB

,

Ottersen

OP

,

000

Fujiyosi

Нильсен

S

.

Водные каналы Aquaporin: от атомной структуры к клинической медицине

.

J Physiol (Лондон).

2002

;

542

:

3

16

. 11.

Endeward

V

,

Musa-Aziz

R

,

Cooper

G

,

Chen

L

,

Pelletier

M

,

Virk2000

,

King

L

,

Бор

W

и др.

Доказательства того, что аквапорин 1 является основным путем переноса CO 2 через мембрану эритроцитов человека

.

FASEB J.

2006

;

20

:

1974

81

.12.

Ханба

YT

,

Шибасака

M

,

Хаяси

Y

,

Хаякава

T

,

Касамо

K

,

0005 Katrashima

Katrashima

Сверхэкспрессия аквапорина ячменя HvPIP2; 1 увеличивает внутреннюю проводимость CO 2 и ассимиляцию CO 2 в листьях трансгенных растений риса

.

Physiol растительных клеток.

2004

;

45

:

521

9

. 13.

Uehlein

N

,

Lovisolo

C

,

Siefritz

F

,

Kaldenhoff

R

.

Табачный аквапорин NtAQP1 представляет собой мембрану CO 2 поры с физиологическими функциями

.

Природа.

2003

;

425

:

734

7

. 14.

Cooper

G

,

Zhou

Y

,

Bouyer

P

,

Grichtchenko

I

,

Boron

W

.

Транспортировка летучих растворенных веществ через AQP1

.

J. Physiol.

2002

;

542

:

17

29

. 15.

Bok

D

,

Dockstader

J

,

Horwitz

J

.

Иммуноцитохимическая локализация основного внутреннего полипептида хрусталика (MIP26) в коммуникативных соединениях

.

J. Cell Biol.

1982

;

92

:

213

20

.16.

Deen

PMT

,

van Os

CH

.

Эпителиальные аквапорины

.

Curr Opin Cell Biol.

1998

;

10

:

435

42

. 17.

фургон Os

CH

,

Kamsteeg

EJ

,

Marr

N

,

Deen

PMT

.

Физиологическое значение аквапоринов: роскошь или необходимость?

Pflueg Arch Eur J Physiol.

2000

;

440

:

513

20

. 18.

Deen

PMT

,

Verdijk

MAJ

,

Knoers

NVAM

,

Wieringa

B

,

Monnens

LAH 9000 Os5

фургон

,

.

Требование аквапорина-2 почечного водного канала человека для вазопрессин-зависимой концентрации в моче

.

Наука.

1994

;

264

:

92

4

.19.

Amiry-Moghaddam

M

,

Otsuka

T

,

Hurn

P

,

Traystman

R

,

Haug

000 F

hner

000

000 F

,

Neely

J

,

Agre

P

и др.

Альфа-синтрофин-зависимый пул aqp4 в конечностях астроглии обеспечивает двунаправленный поток воды между кровью и мозгом

.

Proc Natl Acad Sci USA.

2003

;

100

:

2106

11

.20.

Schrier

RW

,

Chen

YC

,

Cadnapaphornchai

MA

.

От зябликов до рыб и людей: роль аквапоринов в регуляции жидкостей организма и мозга

.

Неврология.

2004

;

129

:

897

904

. 21.

Manley

GT

,

Binder

DK

,

Papadopoulos

MC

,

Verkman

AS

.

Новые сведения о переносе воды и отеках в центральной нервной системе на основе анализа фенотипа мышей без аквапорина-4

.

Неврология.

2004

;

129

:

983

91

. 22.

Li

J

,

Verkman

AS

.

Нарушение слуха у мышей, лишенных водных каналов аквапорина-4

.

J Biol Chem.

2001

;

276

:

31233

7

.23.

Fu

D

,

Libson

A

,

Miercke

LJW

,

Weitzman

C

,

Nollert

P

,

000

000 Stroud5

.

Структура глицеринового проводящего канала и основы его селективности

.

Наука.

2000

;

290

:

481

6

. 24.

Тайхоршид

E

,

Nollert

P

,

Jensen MØ, Miercke

LJW

,

O’Connell

J

,

RM

Stroud

Контроль селективности семейства водных каналов аквапоринов с помощью глобальной ориентационной настройки

.

Наука.

2002

;

296

:

525

30

. 25.

Savage

DF

,

Egea

PF

,

Роблес-Кольменарес

Y

,

O’Connell JD

III

,

Stroud

RM

.

Архитектура и селективность в аквапоринах: 2,5 Å Рентгеновская структура аквапорина Z

.

PLoS Biol.

2003

;

1

:

E72

.26.

Murata

K

,

Mitsuoka

K

,

Hirai

T

,

Walz

T

,

Agre

P

,

Heymann

Fujiyoshi

Y

.

Структурные детерминанты проникновения воды через аквапорин-1

.

Природа.

2000

;

407

:

599

605

.27.

Sui

H

,

Han

BG

,

Lee

JK

,

Walian

P

,

Jap

BK

.

Структурные основы водного транспорта по водному каналу AQP1

.

Природа.

2001

;

414

:

872

8

. 28.

Hiroaki

Y

,

Tani

K

,

Kamegawa

A

,

Gyobu

N

,

Nishikawa

K

000

K

,

9 Suz2000

Sasaki

S

,

Mitsuoka

K

и др.

Влияние структуры Аквапорина-4 на формирование массива и адгезию клеток

.

J Mol Biol.

2005

;

355

:

628

39

. 29.

Gonen

T

,

Sliz

P

,

Kistler

J

,

Cheng

Y

,

Walz

T

.

Мембранные стыки Aquaporin-0 раскрывают структуру закрытой водной поры

.

Природа.

2004

;

429

:

193

7

.30.

Harries

WEC

,

Akhavan

D

,

Miercke

LJW

,

Khademi

S

,

Stroud

R

.

Архитектура каналов аквапорина 0 при разрешении 2,2 ангстрем

.

Proc Natl Acad Sci USA.

2004

;

101

:

14045

50

. 31.

Gonen

T

,

Cheng

Y

,

Sliz

P

,

Hiroaki

Y

,

Fujiyoshi

Y

, Walz5000

9000 SC 9000 9000 9000 SC

Harrison 9000

Липидно-белковые взаимодействия в двухслойных двумерных кристаллах AQP0

.

Природа.

2005

;

438

:

633

8

. 32.

Lee

JK

,

Kozono

D

,

Remis

J

,

Kitagawa

Y

,

Agre

P

,

Rroud

9.

Структурная основа проводимости аквапорина архей AqpM при 1.68å

.

Proc Natl Acad Sci USA.

2005

;

102

:

18932

7

. 33.

Törnroth-Horsefield

S

,

Wang

Y

,

Hedfalk

K

,

Johanson

U

,

Karlsson

M

000

000 E

000 E

000 9000 9000 E

000

,

Kjellbom

P

.

Структурный механизм аквапоринирования растений

.

Природа.

2006

;

439

:

688

94

. 34.

Zhu

F

,

Тайхоршид

E

,

Schulten

K

.

Исследование молекулярной динамики водного канала аквапорина-1 в липидном бислое

.

FEBS Lett.

2001

;

504

:

212

8

0,35.

Jensen MØ, Тайхоршид

E

,

Schulten

K

.

Механизм проведения глицерина в акваглицеропоринах

.

Строение.

2001

;

9

:

1083

93

.36.

Йенсен МО, Парк

S

,

Тайхоршид

E

,

Schulten

K

.

Энергетика проведения глицерина через акваглицеропорин GlpF

.

Proc Natl Acad Sci USA.

2002

;

99

:

6731

6

.37.

de Groot

BL

,

Grubmüller

H

.

Проникновение воды через биологические мембраны: механизм и динамика аквапорина-1 и GlpF

.

Наука.

2001

;

294

:

2353

7

0,38.

Грейсон

П

,

Тайхоршид

E

,

Schulten

K

.

Механизмы селективности каналов и ферментов, изученных с помощью интерактивной молекулярной динамики

.

Biophys J.

2003

;

85

:

36

48

. 39.

Тайхоршид

E

,

Аксиментьев

A

,

Балабин

I

,

Gao

M

,

Isralewitz

B

000

Phill

,

Шультен

К

.

Крупномасштабное моделирование механики и функции белков

.В:

Richards

FM

,

Eisenberg

DS

,

Kuriyan

J

, редакторы.

Успехи химии белков.

66-й т.

Нью-Йорк

:

Elsevier Academic Press

;

2003

. п.

195

247

.40.

Jensen MØ, Тайхоршид

E

,

Schulten

K

.

Электростатическая настройка проницаемости и селективности в водных каналах аквапоринов

.

Biophys J.

2003

;

85

:

2884

99

.41.

Zhu

F

,

Тайхоршид

E

,

Schulten

K

.

Теория и моделирование проницаемости воды в аквапорине-1

.

Biophys J.

2004

;

86

:

50

7

.42.

Илан

B

,

Тайхоршид

E

,

Schulten

K

,

Вот

GA

.

Механизм исключения протонов в аквапориновых каналах

.

Белков.

2004

;

55

:

223

8

. 43.

Тайхоршид

E

,

Cohen

J

,

Аксиментьев

A

,

Сотомайор

M

,

Schulten

K

.

На пути к пониманию мембранных каналов

. In:

Martinac

B

,

Kubalski

A

, редакторы.

Бактериальные ионные каналы и их эукариотические гомологи.

Вашингтон

:

ASM Press

;

2005

. п.

153

190

. 44.

Ван

Y

,

Schulten

K

,

Тайхоршид

E

.

Что делает аквапорин глицериновым каналом: сравнительное исследование AqpZ и GlpF

.

Строение.

2005

;

13

:

1107

18

.45.

Тайхоршид

E

,

Zhu

F

,

Schulten

K

.

Кинетическая теория и моделирование одноканального водного транспорта

. В:

Ип

S

, редактор.

Справочник по моделированию материалов.

1-й т. Методы и модели.

Дордрехт, Нидерланды

:

Springer

;

2005

. п.

1797

1822

. 46.

Yu

J

,

Yool

AJ

,

Schulten

K

,

Тайхоршид

E

.

Механизм стробирования и ионная проводимость возможной тетрамерной поры в Аквапорине-1

.

Строение.

2006

;

14

:

1411

23

. 47.

Pohl

P

,

Saparov

SM

,

Borgnia

MJ

,

Agre

P

.

Высокоселективная активность водных каналов, измеренная с помощью фиксации напряжения: анализ плоских липидных бислоев, восстановленных с помощью очищенного AqpZ

.

Proc Natl Acad Sci USA.

2001

;

98

:

9624

9

. 48.

Сапаров

S

,

Tsunoda

S

,

Pohl

P

.

Исключение протонов акваглицеропротеином: исследование фиксации напряжения

.

Biol Cell.

2005

;

97

:

545

50

,49.

de Groot

BL

,

Frigato

T

,

Helms

V

,

Grubmüller

H

.

Механизм исключения протонов в водном канале аквапорина-1

.

J Mol Biol.

2003

;

333

:

279

93

.50.

Бурыкин

А

,

Варшел

А

.

Что на самом деле препятствует переносу протонов через аквапорин? Заряд собственной энергии в сравнении с предложениями по протонной проволоке

.

Biophys J.

2003

;

85

:

3696

706

.51.

Чакрабарти

N

,

Тайхоршид

E

,

Roux

B

,

Pomès

R

.

Молекулярные основы блокировки протонов в аквапоринах

.

Строение.

2004

;

12

:

65

74

. 52.

Бурыкин

А

,

Варшел

А

.

О происхождении электростатического барьера для транспорта протонов в аквапорине

.

FEBS Lett.

2004

;

570

:

41

6

. 53.

de Groot

BL

,

Grubmüller

H

.

Динамика и энергетика проникновения воды и исключения протонов в аквапоринах

.

Curr Opin Struct Biol.

2005

;

15

:

176

83

. 54.

de Groot

BL

,

Engel

A

,

Grubmüller

H

.

Уточненная структура человеческого аквапорина-1

.

FEBS Lett.

2001

;

504

:

206

11

. 55.

Zhu

F

,

Тайхоршид

E

,

Schulten

K

.

Перенос воды под давлением в мембранных каналах изучен методом молекулярной динамики

.

Biophys J.

2002

;

83

:

154

60

. 56.

de Groot

BL

,

Grubmüller

H

.

Динамика и энергетика проникновения воды и исключения протонов в аквапоринах

.

Curr Opin Struct Biol.

2005

;

15

:

176

83

. 57.

Domene

C

,

Bond

P

,

Deol

SS

,

Sansom

M

.

Липид / белковые взаимодействия и межфазная область мембрана / вода

.

J Am Chem Soc.

2003

;

125

:

14966

7

.58.

Nilsson

J

,

Persson

B

,

von Heijne

G

.

Сравнительный анализ распределения аминокислот в интегральных мембранных белках 107 геномов

.

Белков.

2005

;

60

:

606

16

. 59.

Hessa

T

,

Kim

H

,

Bihlmaier

K

,

Lundin

C

,

Boekel

J

,

Andersson

,

Andersson

Белый

SH

,

von Heijne

G

.

Распознавание трансмембранных спиралей транслоконом эндоплазматического ретикулума

.

Природа.

2005

;

433

:

377

81

.60.

фон Хейне

G

.

Топология мембрана-белок

.

Nat Rev Mol Cell Biol.

2006

;

7

:

909

18

.61.

Heller

KB

,

Lin

EC

,

Wilson

TH

.

Субстратная специфичность и транспортные свойства глицеринового ускорителя Escherichia coli

.

J Bacteriol.

1980

;

144

:

274

8

0,62.

Borgnia

MJ

,

Agre

P

.

Восстановление и функциональное сравнение очищенных GlpF и AqpZ, каналов глицерина и воды из Escherichia coli

.

Proc Natl Acad Sci USA.

2001

;

98

:

2888

93

.63.

Ikeda

M

,

Beitz

E

,

Kozono

D

,

Guggino

WB

,

Agre

P

,

Masui

Характеристика аквапорина-6 как нитратного канала в клетках млекопитающих. Требование остатка выстилки поры треонина 63

.

J Biol Chem.

2002

;

277

:

39873

9

.64.

Liu

Z

,

Shen

J

,

Carbrey

JM

,

Mukhopadhyay

R

,

Agre

P

,

BP

.

Транспорт арсенита акваглицеропоринами млекопитающих AQP7 и AQP9

.

Proc Natl Acad Sci USA.

2002

;

99

:

6053

8

0,65.

Yasui

M

,

Hazama

A

,

Kwon

TH

,

Nielsen

S

,

Guggino

WB

,

000 Agre

,

Agre

Быстрое гейтирование и анионная проницаемость внутриклеточного аквапорина

.

Природа.

1999

;

402

:

184

7

0,66.

Hazama

A

,

Kozono

D

,

Guggino

WB

,

Agre

P

,

Yasui

M

.

Ионная проницаемость белка водного канала AQP6: одноканальная запись после активации Hg

.

J Biol Chem.

2002

;

277

:

29224

30

0,67.

Yool

AJ

,

Weinstein

AM

.

Новые роли старых дырок: функция ионного канала в аквапорине-1

.

Новости Physiol Sci.

2002

;

17

:

68

72

.68.

Цзян

Дж

,

Дэниэлс

B

,

Fu

D

.

Кристаллическая структура тетрамера aqpz выявляет две различные конформации arg-189, связанные с проникновением воды через самое узкое сужение водопроводящего канала

.

J Biol Chem.

2006

;

281

:

454

60

0,69.

Isralewitz

B

,

Gao

M

,

Schulten

K

.

Управляемая молекулярная динамика и механические функции белков

.

Curr Opin Struct Biol.

2001

;

11

:

224

30

.70.

Немет-Кахалан

K

,

Холл

J

.

pH и кальций регулируют водопроницаемость аквапорина 0

.

J Biol Chem.

2000

;

275

:

6777

82

. 71.

Tournaire-Roux

C

,

Sutka

M

,

Javot

H

,

Gout

E

,

Gerbeau

P

,

9000 D

000

9000 D Luu

,

Maurel

C

.

Цитозольный pH регулирует транспорт воды в корнях во время аноксического стресса за счет пропускания аквапоринов

.

Природа.

2003

;

425

:

393

7

,72.

Зеленина

M

,

Зеленина

S

,

Бондарь

AA

,

Brismar

H

,

Aperia

A

.

Водопроницаемость аквапорина-4 снижается протеинкиназой С и дофамином

.

Am J Physiol Ren Physiol.

2002

;

283

:

F309

18

.73.

Yool

A

,

Stamer

W

,

Regan

J

.

Моделирование форсколина проницаемости для воды и катионов в водных каналах аквапорина 1

.

Наука.

1996

;

273

:

1216

8

,74.

Энтони

T

,

Брукс

H

,

Боасса

D

,

Леонов

S

,

Яночко

G

,

000 Yanochko

Regan

o

Клонированный человеческий аквапорин-1 представляет собой циклический GMP-управляемый ионный канал

.

Mol Pharmacol.

2000

;

57

:

576

88

,75.

Nakhoul

N

,

Davis

B

,

Romero

M

,

Boron

W

.

Влияние экспрессии водного канала аквапорина-1 на проницаемость по CO 2 ооцитов Xenopus

.

Am J Physiol.

1998

;

274

:

C543

8

,76.

Cooper

G

,

Бор

W

.

Влияние PCMBS на CO 2 проницаемость ооцитов Xenopus , экспрессирующих аквапорин 1 или его мутант C189S

.

Am J Physiol.

1998

;

275

:

C1481

6

,77.

Prasad

GVT

,

Coury

LA

,

Finn

F

,

Zeidel

ML

.

Водные каналы восстановленного аквапорина 1 переносят CO 2 через мембраны

.

J Biol Chem.

1998

;

273

:

33123

6

,78.

Терашима

I

,

Оно

К

.

Влияние HgCl 2 на CO 2 зависимость фотосинтеза листа: данные, указывающие на участие аквапоринов в диффузии CO 2 через плазматическую мембрану

.

Physiol растительных клеток.

2002

;

43

:

70

8

,79.

Пустой

M

,

Ehmke

H

.

Аквапорин-1 и HCO 3 -Cl Транспорт CO 2 через мембрану эритроцитов человека

.

J. Physiol.

2003

;

550

:

419

29

.80.

Ван

Y

,

Cohen

J

,

Бор

WF

,

Schulten

K

,

Тайхоршид

E

.

Исследование газопроницаемости клеточных мембран и мембранных каналов с помощью молекулярной динамики

.

J. Struct Biol.

2007

;

157

:

534

44

.81.

Smart

O

,

Goodfellow

J

,

Wallace

B

.

Размеры пор грамицидина А

.

Biophys J.

1993

;

65

:

2455

60

.

Сокращения

  • AQP

  • Arg

  • cGMP

    Циклический гуанозинмонофосфат

  • MD

  • Phe 902 902 SF24 9223

    902 SF24

  • 902 SF24

  • © 2007 Американское общество питания

    аквапоринов в растениях | Физиологические обзоры

    A.Контекст

    Наземные растения образуют непрерывный поток воды между почвой и атмосферой (273) ( РИСУНОК 1 ). Одним из примеров является транспирация растений, которая приводит в движение восходящий поток воды, интенсивность которого в первую очередь определяется гидравлическими сопротивлениями, пересекаемыми в континууме почва-растение-атмосфера. Гидравлические процессы, действующие на границах раздела почва-корень (ризосфера) и лист-воздух (устьица), имеют решающее значение во время транспирации, но не будут здесь обсуждаться, поскольку они не затрагивают клеточные мембраны и аквапорины.В этом разделе основное внимание уделяется водному транспорту внутри завода. Функциональная характеристика аквапоринов дала мощный импульс более ранним исследованиям по этой теме (273), основанным на их физических концепциях и предоставив молекулярную и клеточную информацию о ранее описанных физиологических регуляторах гидравлики клеток и тканей (46, 189).

    Перенос воды во внутренних тканях растения на самом деле регулируется множеством правил, которые, как правило, стабилизируют водный статус растений и предоставляют средства для адаптации растения к окружающей среде.Например, водопроницаемость корней (гидравлическая проводимость корней; L p r ) сильно зависит от содержания в почве воды, питательных веществ и кислорода, тогда как гидравлика листа чувствительна к влажности воздуха и световому режиму. Температура и суточные ритмы также оказывают общее влияние на гидравлику растений. Скоординированная регуляция транскрипции аквапоринов гормональными факторами и факторами окружающей среды (5, 34, 116) и, в частности, абиотическими стрессами (92, 172, 340) дала первый намек на общую роль аквапоринов во время этих процессов.Как подробно описано ниже, множественные посттранскрипционные механизмы предоставляют дополнительные средства для тонкой настройки аквапоринов и транспорта воды в корнях и листьях.

    B. Корневой водный транспорт

    1. Анализ структуры-функции

    У всех высших растений поглощение корневой воды опосредуется радиальным (центростремительным) транспортом из почвы в сосуды ксилемы через эпидермис, кору, энтодерму и стелу. ткани ( РИСУНОК 9 A ). Попадая в сосуды, вода (ксилемный сок) течет в осевом направлении к побегам растений.Во время радиального транспорта вода может течь вдоль структур клеточной стенки (апопластический путь) или от клетки к клетке, по непрерывности цитоплазмы, образованной плазмодесмами (симпластический путь) или через клеточные мембраны (трансцеллюлярный путь). Для формализации переноса воды по этой сети была разработана так называемая составная модель корня (274). Модель может учитывать перенос воды в условиях протекания, когда преобладают гидростатические движущие силы (давления и напряжения), или в условиях корневого давления, когда перенос воды в основном осуществляется за счет переноса растворенных веществ и осмотических сил.Модель также объясняет, как пути переноса воды и, следовательно, L p r могут изменяться в зависимости от режима переноса воды в растении (274). В то время как в большинстве исследований предполагалось, что вода течет в тканях корня по градиентам водного потенциала путем диффузии через клеточные стенки, липиды или водные каналы, недавно была выдвинута гипотеза о роли переносчиков растворенных веществ в локализованной перекачке воды в гору (316).

    РИСУНОК 9. Водный транспорт и экспрессия аквапоринов в корнях. A : схематическое изображение поперечного сечения корня Arabidopsis (розовый – эпидермис; синий – кора и энтодерма; зеленый – перицикл; коричневый – стела и сосуды ксилемы). Вода течет от клетки к клетке, а пути апопласта показаны синими стрелками. B – D : радиальные и продольные разрезы корней Arabidopsis , экспрессирующих AtPIP1; 2-GUS ( B ; кат. 230), AtPIP2; 2-GUS ( C ; кат. 119) или АтПИП2; 1-ГУС (D ; Ref.226) трансгены, которые обеспечивают экспрессию репортерного гена β-глюкуронидазы ( GUS ) под контролем указанных промоторов PIP. Эти изображения показывают, как разные изоформы аквапорина проявляют разные паттерны экспрессии, хотя все они экспрессируются в стеле. Полосы = 50 мкм ( B ), 50 мкм ( C ) или 25 мкм ( D ).

    Блокаторы аквапоринов, и в частности ртуть, использовались в качестве удобных инструментов для проверки вклада аквапоринов в составную модель переноса корневой воды.Ингибирование ртути L p r показало, что относительная важность трансцеллюлярного (аквапорин-зависимого) пути может варьироваться между видами растений и преобладает у томатов Arabidopsis , где она составляет от 57% до 64%. L p r соответственно (175, 275). В настоящее время фармакология растительных аквапоринов остается весьма ограниченной, все описанные ингибиторы потенциально токсичны и обладают многочисленными вторичными эффектами. Тем не менее, более высокая надежность может быть получена, когда ингибиторы с различными механизмами действия (ртуть в сравнении со слабыми кислотами или азидом) дают аналогичные оценки аквапорин-зависимого пути (275).

    Паттерны экспрессии аквапоринов также могут дать полезные подсказки о вкладе водных каналов в транспорт корневой воды. Эти закономерности были исследованы в корнях многих видов растений с наиболее точными описаниями в Arabidopsis (83, 119, 230) ( РИСУНОК 9, B – D ) и злаках, таких как рис (251), кукуруза (97 ) и ячменя (136). Помимо своей агрономической важности, злаки представляют собой интересный контекст для изучения функций корней, поскольку семенные и побеговые корни демонстрируют различную морфологию и функции.Исследования экспрессии аквапорина в корнях были сосредоточены на PIP, которые предположительно играют решающую роль в плазматической мембране и трансклеточном транспорте воды, а также на TIP, которые показывают высокие уровни экспрессии в корнях. Например, корень Arabidopsis экспрессирует по крайней мере семь изоформ PIP и шесть изоформ TIP со специфическими паттернами экспрессии, причем последние экспрессируются во всех тканях, кроме сосудистой сети и меристемы кончика корня (83). У всех исследованных видов растений можно установить очень точные и отличные клеточно-специфические паттерны экспрессии для многочисленных изоформ аквапоринов, присутствующих в корнях (97, 251).В целом, данные подчеркивают важность контроля локальных гидравлических свойств на всем протяжении радиального пути с преимущественной экспрессией некоторых изоформ в экзодерме или энтодерме (97). Барьеры апопласта образуются в этих двух клеточных слоях в результате отложения лигнина на полосках Каспариана и последующей суберизации всей апоплазмы, тем самым создавая специфические ограничения для транспорта воды. Кроме того, высокая экспрессия некоторых других изоформ в стеле согласуется с центростремительным переносом воды к сосудистой сети корня, в результате чего потоки воды должны опосредоваться уменьшенными поверхностями обмена (80, 230) ( РИСУНОК 9, B – D ).Профили экспрессии аквапорина также изменяются вдоль оси корня, указывая на то, что сам радиальный путь изменяется во время роста и дифференцировки корня. В некоторых случаях эти исследования сочетались с измерениями переноса воды в четко определенных корневых зонах (80, 136). Недавние сравнения водного транспорта и экспрессии аквапоринов в древесных многолетних и травянистых растениях показали различные профили гидравлической дифференциации корней между этими типами растений (80). Например, у виноградной лозы радиальный путь в дифференцированных сегментах корня кажется чрезвычайно узким из-за образования перидермы, что позволяет предположить, что почвенная вода попадает в основном через кончики корней.

    В дополнение к анализу экспрессии обратная генетика предоставила недвусмысленные доказательства вклада PIPs в L p r (119, 226, 230, 267). Несмотря на умеренную амплитуду (изменение на 10–20% в L p r ), у мутантов с единичным нокаутом можно было наблюдать значительные фенотипы водного транспорта. Тем не менее, эти исследования оставались ограниченными несколькими изоформами, и необходимо учитывать генетическую избыточность между близкими гомологами (226). Таким образом, нам все еще не хватает всестороннего молекулярного представления о корневой гидравлике, согласно которому каждая изоформа может быть связана с переносом воды в определенных клеточных участках и под действием определенного типа силы.

    Моделирование переноса корневой воды вдоль концентрических слоев клеток и корневой оси или в отдельных подтипах корня (37, 137) может оказать существенную поддержку этим функциональным и генетическим анализам. Эти модельные исследования показывают, что место поглощения воды (кончики корней по сравнению с целым корнем) может различаться у разных видов. Задача будущего будет заключаться в том, чтобы интегрировать гидравлическое функционирование корней в почве, чтобы учесть все кинетические и пространственные уточнения водопоглощения в естественной среде (64).Эти исследования не должны ограничиваться травянистыми видами. Например, использование естественных пещер показало, что аквапорины живого дуба и камеди бумелии ( Sideroxylon lanuginosum ) способствуют поглощению корневой воды глубоко в почву (18–20 м), где они могут реагировать на сезонные и суточные ритмы (190). .

    2. Водный стресс

    Прямое воздействие на корни водного стресса обычно приводит к подавлению активности аквапоринов и транспорта воды на уровне клеток и целых органов (34, 43, 99, 227, 275).Тем не менее, некоторые сорта растений или естественные образцы демонстрируют противоположную реакцию при увеличении гидравлической проводимости корневых клеток (99, 275). Эффекты внешней (106, 176) или эндогенной АБК (223) также различаются во времени и между видами. Например, АБК временно увеличивает гидравлическую проводимость клеток в клетках корня кукурузы (106), тогда как она ингибирует L p r у осины (311). Эти наблюдения подчеркивают разнообразие гидравлических стратегий в ответ на высыхание почвы.В то время как увеличение L p r во время ранней фазы засухи может помочь оптимизировать захват водных ресурсов почвы, долгосрочное ингибирование обеспечивает более консервативный механизм для растения, предотвращающий обратный поток воды от растения. укорениться в сухой почве. Регулирование полного корневого водного транспорта также может иметь сильное гидравлическое воздействие на листья, способствуя или уменьшая рост или воздействуя на устьичную апертуру (транспирацию) (см. Раздел VII A3 ).

    Теперь необходимо выйти за рамки классических и резких настроек водного стресса, используемых в лабораториях.В частности, неоднородность содержания влаги в почве в естественных условиях необходимо будет более тщательно рассмотреть в будущих экспериментальных исследованиях, чтобы понять, как корни растений ощущают дефицит воды в почве и управляют водой в почве в долгосрочной перспективе. Частичная сушка корневой зоны прибрежного дерева ( Melaleuca argentea ) привела к трехкратному увеличению гидравлической проводимости корней во влажной части почвы с небольшим увеличением экспрессии PIP1 за счет сигнального механизма, который еще предстоит идентифицировать (191).Кроме того, неоднородности в местной гидравлической проводимости могут препятствовать перераспределению воды (гидравлический подъем) между слоями почвы, различающимися по влагосодержанию (40).

    3. Доступность питательных веществ

    Корневой водный транспорт и активность аквапоринов чрезвычайно чувствительны к доступности питательных веществ в почве. Недостаток у растений большинства макроэлементов (фосфор, азот или сера) в течение нескольких дней приводит к снижению L p r (42, 62) за счет подавления аквапорина ( РИСУНОК 10 ).Предполагается, что эти правила могут способствовать поглощению всей воды в условиях, благоприятных для роста растений. Принимая во внимание возможные неоднородности почвы, эти правила могут также усилить перенос питательных веществ к корням в зонах почвы, которые наиболее богаты питательными веществами. В отличие от этих эффектов калиевое (K + ) голодание усиливает L p r (157, 236). Способы регуляции аквапоринов питательными веществами кажутся сложными, поскольку они включают смешанные эффекты на экспрессию и фосфорилирование аквапорина (62, 88, 157, 313).

    РИСУНОК 10. Аквапорин-зависимое подавление транспорта корневой воды во время абиотических стрессов. На рисунке показан сокодород ( J v), выделяемый отделившимися корневыми системами пшеницы. Корни контрольных растений, обработанные сначала 50 мкМ HgCl 2 , а затем 5 мМ DTT, подчеркивают роль аквапорин-зависимого пути в переносе корневой воды (синие закрашенные кружки). J v в корнях растений, лишенных азота (N) и фосфора (P) (красные и зеленые закрашенные кружки соответственно), намного ниже и не проявляет чувствительности к ингибированию HgCl 2 .Вывод этого знаменательного эксперимента состоит в том, что подавление транспорта воды в корневой системе растений при дефиците азота и фосфора опосредуется аквапориновой регуляцией. [Перерисовано из Carvajal et al. (42).]

    Сигнальные механизмы, которые опосредуют эти эффекты, пока неизвестны, но явно связаны с гормональными ответами. Таким образом, было показано, что этилен опосредует ингибирующие эффекты фосфорного голодания на L p r в Medicago falcata (151), тогда как ABA усиливает стимуляцию L p r за счет голодания K + у подсолнечника (236 ).Также будет важно изучить соответствующий вклад местных и системных сигналов в эти правила (87).

    4. Другие сигналы почвы

    Как низкие температуры, так и недостаток кислорода в почве оказывают общее ингибирующее действие на поглощение воды корнями за счет снижения гидравлической проводимости клеток и всего корня. Холод оказывает комплексное повышающее и подавляющее действие на экспрессию PIP в корнях (144, 329). АФК и кальций, которые накапливаются в этих условиях, и фосфорилирование аквапоринов могут обеспечивать дополнительные механизмы для индуцированной холодом регуляции L p r (144, 145).У риса длительное (2–5 дней) воздействие низких температур на корни индуцировало компенсаторное увеличение L p r , в значительной степени из-за повышенной экспрессии Os PIP2; 5 (2). Интересно, что эта индукция требовала, чтобы побег поддерживался как при контрольной температуре, так и в его целостности, что позволяет предположить, что был задействован сигнал от побега к корню (см. Раздел VI B6 ).

    Затопление и уплотнение почвы предотвращают диффузию кислорода, тем самым создавая серьезную аноксическую нагрузку, особенно на активно растущие кончики корней.Этот стресс приводит к сильному метаболическому дисбалансу с выраженным цитозольным ацидозом, который, в свою очередь, опосредует H + -зависимое включение PIPs (287). Долгосрочные эффекты аноксии опосредованы общим ингибированием экспрессии гена аквапорина (156). Интересно, что ген AtNIP2; 1 демонстрирует сильную индукцию в корнях Arabidopsis при аноксическом стрессе. Этот аквапорин, переносящий молочную кислоту, может способствовать проникновению в почву этого продукта ферментации, тем самым предотвращая чрезмерное подкисление клеток (50).

    5. Суточные и циркадные ритмы

    Что касается суточных изменений транспирации, у многих видов растений наблюдается пик в L p r в течение дня (103, 250). Эта регуляция может быть объяснена увеличением количества транскриптов аквапоринов корня в течение ранней фазы дня (163, 279, 298) и слегка отсроченным пиком содержания белка (99, 250). Эксперименты при постоянном освещении и / или с мутантами по циркадным часам показали, что, по крайней мере, у кукурузы и Arabidopsis эти колебания находятся под контролем циркадных ритмов (39, 279).У кукурузы амплитуда этих колебаний резко усиливается из-за того, что растения ранее подвергались водоограничивающим условиям в воздухе или в почве. Такой климатический контроль позволит оптимизировать водопоглощение умеренно засушливых почв за счет сохранения гидратации ризосферы (39). Корни также могут напрямую ощущать свет. Например, фоторецепторный фитохром А контролирует усиление экспрессии At TIP2; 2 во время адаптации корня Arabidopsis к темноте (296).

    6. Транспирационная потребность и другие сигналы от побегов к корням

    Недавние исследования риса и тополя (142, 250) установили прямую роль транспирационной потребности в регуляции L p r . Это стало возможным благодаря независимому манипулированию несколькими факторами, влияющими на транспирацию (например, свет или относительная влажность воздуха), чтобы исключить первичное влияние этих факторов на функции аквапоринов. У обоих видов растений транспирация вызвала резкое увеличение экспрессии гена PIP в корнях.

    Определение системных сигналов, передаваемых от побегов для регулирования корневой гидравлики, представляет собой один из самых интересных вопросов в этой области. Несколько исследований определили контекст для рассмотрения этой темы. Например, было показано, что верхушка побегов виноградной лозы, сои и кукурузы снижает активность и экспрессию аквапоринов корня L p r за несколько десятков минут (299). В то время как сигналы, передаваемые ауксином или флоэмой, по-видимому, исключены, гидравлические сигналы, передаваемые через ксилему, более вероятны.У проростков осины ( Populus tremuloides ) дефолиация приводит к корректировке как листовой, так и корневой гидравлики. Снижение L p r , наблюдаемое через 1 день, было связано с подавлением основной изоформы PIP1 (159). У пшеницы частичное удаление корня не повлияло ни на устьичную проводимость, ни на транспирацию, но через 1,5 часа увеличило гидравлическую проводимость оставшегося корня в несколько раз по сравнению с повышенным накоплением АБК в этом органе (307).

    C. Водный транспорт в листьях

    1. Гидравлическое сопротивление в листьях

    После поглощения корнями почвенная вода, обогащенная питательными веществами, транспортируется в виде сока к побегам растений через ксилемные сосуды, сформированные из мертвых клеточных структур. За исключением сильной засухи (49), перенос ксилемы в стебле неограничен. Напротив, лист представляет собой, помимо корня, важную контрольную точку для водного транспорта растений. Фактически, гидравлика внутренних тканей листа предназначена для эффективной доставки сока через сеть тонких сосудов ксилемы в субоматальные камеры, где вода испаряется и проходит через устьичные поры.

    Гидравлика листа, таким образом, определяется сосудистым (ксилема) и внесосудистым сопротивлением, соответствующие вклады которых варьируются в зависимости от видов растений и морфологии листьев (233). Внесосудистый путь образован клетками паренхимы, упакованными вдоль сосудов, окруженными плотной оболочкой пучка и мезофиллом, который показывает более рыхлое уплотнение с многочисленными лакунами ( РИСУНОК 11 A ). Подобно корням, вода может течь в листьях по апопластическому пути или от клетки к клетке.

    РИСУНОК 11. Транспорт воды и экспрессия аквапоринов в листьях. A : схематическое изображение части листа Arabidopsis (синий – эпидермис; зеленый – мезофилл; коричневый – оболочка пучка; фиолетовый – проводящие ткани). Вода течет от клетки к клетке, а пути апопласта показаны фиолетовыми стрелками. B : окрашивание всего органа или срезов листьев Arabidopsis , экспрессирующих трансгены PIP1; 2-GUS , PIP2; 1-GUS , PIP2; 6-GUS или PIP2; 7-GUS . (230, 232).На рисунках показан уникальный паттерн экспрессии листьев для каждой изоформы. Черные полосы = 2,5 мм; красные полосы = 0,1 мм.

    Вклад аквапоринов в водный транспорт листа был проанализирован с использованием подходов, аналогичных тем, которые используются в корнях. Исследования экспрессии выявили высокое содержание аквапоринов в удлиненной зоне листьев злаков, в сосудистых пучках большинства видов растений и, в меньшей степени, в мезофилле (23, 95, 232) ( РИСУНОК 11 B ). Обратный генетический анализ Arabidopsis выявил три изоформы PIP, которые вносят вклад в гидравлику листа (230, 232).Несколько линий доказательств указывают на то, что, по крайней мере, у Arabidopsis , вены (паренхима ксилемы и клетки влагалища пучка), а не мезофилл, являются гидравлически ограничивающими. Во-первых, все PIPs, вносящие вклад в гидравлическую проводимость розетки, имеют общее выражение в сосудистых пучках (232). Во-вторых, водопроницаемость протопластов, очищенных от жилок, но не от мезофилла, регулируется светом и АБК, что аналогично регулированию всего листа (232, 264). В-третьих, комплементация с использованием специфической для жилок экспрессии AtPIP2; 1 , нокаут-мутанта Atpip2; 1 , лишенного светозависимой регуляции гидравлики листа, была достаточной для восстановления ответа дикого типа (232).

    2. Сигналы

    Гидравлика листа контролируется многочисленными экологическими или гормональными сигналами, которые чаще всего устанавливают функциональную связь между регулированием внутреннего транспорта воды в листе и движениями устьиц. Например, АБК ингибирует транспорт воды внутри листа, подавляя активность аквапорина в клетках оболочки пучка (264). Эти эффекты физиологически согласуются с дополнительной и прямой индукцией закрытия устьиц гормоном. В более общем плане, сильная корреляция между гидравлической и устьичной проводимостью листа и экспрессией гомолога TIP2 наблюдалась в листьях виноградной лозы как в условиях достаточного количества воды, так и в условиях водного стресса (231).

    Помимо водного стресса, световой режим является еще одним сигналом, который определяет гидравлическое регулирование листа. У большинства видов растений гидравлическая проводимость листьев максимальна в дневное время, а у подсолнечника установлен суточный контроль (210). У нескольких видов деревьев, включая орех ( Juglans regia ), дуб черешчатый ( Quercus robur ) и бук обыкновенный ( Fagus sylvatica ), светозависимая гидравлическая проводимость листьев хорошо коррелировала с экспрессией гена PIP (15 , 51).В отличие от Arabidopsis , количественная протеомика показала, что дифосфорилированная форма At PIP2; 1 была тесно связана с изменениями в гидравлической проводимости розетки при различных световых или темных режимах (232). Способность фосфомиметика, но не фосфодефицитной формы At PIP2; 1 восстанавливать световой ответ нокаут-мутанта Atpip2; 1 установила, что фосфорилирование этой единственной изоформы необходимо для светозависимой регуляции гидравлики листа.

    Метаболизм крассулообразной кислоты (CAM) позволяет некоторым растениям адаптироваться к среде с низким содержанием воды за счет дневных / ночных колебаний поглощения и фиксации CO 2 . В листьях ледяного растения осмотическая водопроницаемость очищенных протопластов и экспрессия трех PIP и изоформ TIP достигают пика в конце светового периода вместе с накоплением метаболитов цикла САМ. Таким образом, суточная регуляция аквапоринов может способствовать осморегуляции клеток и водному балансу листа на протяжении всего цикла САМ (302).

    3. Защитные клетки и движения листьев

    Устьевая апертура постоянно регулируется за счет обратимых изменений объема замыкающих клеток и играет важную роль в контроле транспирации растений. В то время как роль аквапоринов в движении устьиц давно выдвигалась гипотезами, подтверждающие данные остались скудными, скорее предполагая их роль в закрытии устьиц. Например, сверхэкспрессия Vicia faba PIP1 в Arabidopsis ускоряла ответ устьиц на темноту и АБК (55).В замыкающих клетках подсолнечника изоформа TIP показала дневной пик экспрессии, который совпадает с закрытием устьиц (256). Что касается обилия информации о передаче сигналов гормонов и регуляции мембранного транспорта в замыкающих клетках, то теперь становится важным получение лучшего понимания функции аквапорина в этих клетках.

    Другие типы движений листьев, по-видимому, связаны с циркадной регуляцией аквапоринов. У дождевого дерева ( Samanea saman ) такая регуляция способствует суточным колебаниям осмотической проницаемости воды в моторных клетках и, как следствие, суточным движениям листьев (205).Точно так же эпинастическое движение листьев табака зависит от циркадной экспрессии гомолога PIP1 ( Nt, AQP1) в черешке (266).

    4. Восстановление эмболии

    Передача воды на большие расстояния в сосудистых растениях может быть существенно затруднена из-за эмболий в сосудах ксилемы после замерзания тканей зимой (249) или в условиях сильной засухи, когда интенсивная транспирация и ограничение водоснабжения привести к высокому напряжению внутри сосудов (165). Изменения в экспрессии аквапоринов, связанные с восстановлением эмболии и ингибированием этого процесса ртутью, позволили предположить, что водный транспорт, обеспечиваемый аквапорином, может способствовать повторному заполнению эмболии (165, 249, 260).Соответственно, трансгенный тополь и Arabidopsis со сниженной экспрессией PIP были более восприимчивы к эмболиям, вызванным засухой, и показали снижение реакции восстановления водной проводимости всего растения при повторном поливе, соответственно (182, 259). Тем не менее, способы котранспорта воды и растворенных веществ, позволяющие восполнить эмболию в тканях при сильном водном напряжении, все еще обсуждаются (104, 316).

    5. Поглощение воды

    В некоторых очень специфических физиологических условиях или видах листья могут заменять корни при поглощении внешней воды.В атмосферных эпифитах, например, поглощение влаги из воздуха через трихомы может обеспечить сильную адаптацию к засухе (218). У хвойных растений поглощение талым снегом листьями может способствовать восполнению эмболии после зимы (141). В обоих случаях о роли аквапоринов в уравновешивании воды в тканях листа свидетельствовали паттерны экспрессии аквапоринов или фармакологическое ингибирование.

    D. Перспективы

    1. Молекулярное рассечение гидравлики тканей растений

    Несмотря на ожидаемую генетическую избыточность в семействе аквапоринов, несколько исследований выявили отдельные изоформы аквапоринов, которые в лабораторных условиях вносят значительный вклад в гидравлику корней или листьев (56 , 119, 226, 230, 232).Мы надеемся, что эти достижения будут способствовать более тщательному генетическому анализу переноса воды в тканях растений. Кроме того, особое внимание следует уделять функции аквапорина в клеточных слоях, которые считаются гидравлически ограничивающими, таких как энтодерма и экзодерма в корнях или клетки оболочки пучка в листьях. Например, критическая роль аквапоринового пути в суберизованных тканях корня предполагалась в большинстве учебников, но была исследована лишь в нескольких исследованиях (80, 238). Одним из важнейших подходов в будущем может стать использование тканеспецифических промоторов для сортировки клеток или направленной экспрессии аквапоринов (232, 244, 264).

    Что наиболее важно, идентификация главных регуляторов аквапоринов в этих клеточных контекстах будет критически необходима. В будущем количественная генетика гидравлики растений в контролируемых или стрессовых условиях (275) может обеспечить привилегированный доступ к этим регуляторам. На данный момент, как описано ниже, расчленение сетей регуляции аквапоринов с использованием возможностей транскриптомных и протеомных подходов обеспечивает более оперативные стратегии.

    2. Факторы транскрипции и транскрипционные сети

    Множество литературных отчетов описывают, как сигналы окружающей среды, развития или гормональные сигналы влияют на водные отношения у многих видов растений и последовательно действуют на регуляцию отдельных аквапоринов.Теперь необходимо выйти за рамки этих индивидуальных исследований и получить доступ к единому пониманию задействованных механизмов и их интеграции в ответные реакции всего растения.

    Что касается регуляции гена аквапоринов, значительного прогресса можно ожидать от геномных исследований. Несколько исследований касались регуляции всего семейства аквапоринов (5, 34, 92, 116, 252, 340), и сети коэкспрессии генов могут показать, как регуляция отдельных аквапоринов связана с регуляцией других изоформ или важных физиологических функций (4).Еще одним важным направлением будет идентификация факторов транскрипции, которые действуют как главные регуляторы генов аквапоринов. Недавно была установлена ​​роль факторов, реагирующих на водный стресс, принадлежащих к семействам DREB (237) и ASR1 (240). Также появляется регуляция экспрессии аквапорина дополнительными факторами транскрипции этилена (225) или абиотическим стрессом (325, 341). Кроме того, аквапорины растений являются предполагаемыми мишенями для микроРНК хлопка (333) и картофеля (335). Влияние этих и других эпигенетических регуляций на водные отношения растений еще не изучено.

    Подобные успехи ожидаются и на уровне протеина. Сеть взаимодействия белков, включающая аквапорины (53, 123), должна выявить еще неизвестные функциональные взаимодействия и помочь идентифицировать взаимодействие аквапоринов с новыми клеточными функциями.

    3. Общая роль фосфорилирования

    Поддержание водного статуса растений при постоянно меняющихся условиях освещения, температуры или доступности воды требует постоянных гидравлических регулировок клеток и тканей. Фосфорилирование аквапоринов обеспечивает решающее средство для такой быстрой и обратимой регуляции без затрат, связанных с синтезом и деградацией белка.Количественная протеомика корней Arabidopsis выявила общую корреляцию между абиотическими и пищевыми стимулами между L p r и фосфорилированием аквапорина (62). Этот тип подхода (200, 232, 234) должен быть усовершенствован для идентификации наиболее важных сигналов и изоформ аквапоринов, участвующих в корнях и других органах. Наиболее важно то, что предполагаемые правила должны быть функционально подтверждены экспрессией в трансгенных растениях фосфомиметических и фосфодефицитных форм задействованной изоформы аквапорина (232).

    Изучение восходящих сигнальных событий также представляет собой важную задачу для будущих исследований. Новаторская работа недавно идентифицировала SIRK1, протеинкиназу, участвующую в ответах растений на сахар и нацеленных на PIP (318). Гипотетические каскады фосфорилирования, запускаемые этиленом и негативно регулирующие фосфорилирование аквапоринов, были недавно смоделированы (326). Тем не менее, предстоит проделать огромную работу по идентификации многочисленных протеинкиназ и протеинфосфатаз, которые, вероятно, регулируют аквапорины.АБК-зависимое фосфорилирование может иметь центральное значение (135), но мы по-прежнему игнорируем задействованные сигнальные компоненты.

    Транспорт активных форм кислорода и азота через аквапорин: молекулярный уровень Изображение

    Аквапорины (AQP) – это трансмембранные белки, которые проводят через клеточную мембрану не только молекулы воды, но и другие растворенные вещества, такие как активные формы кислорода и азота (RONS) , произведенные (среди прочего) холодной атмосферной плазмой (CAP). Эти RONS могут вызывать окислительный стресс внутри клетки, что играет роль в лечении рака.Однако лежащие в основе механизмы транспорта RONS через AQP все еще остаются неясными. Мы применяем моделирование молекулярной динамики для исследования проникновения как гидрофильных (H 2 O 2 и OH), так и гидрофобных (NO 2 и NO) RONS через AQP1. Наше моделирование показывает, что все эти RONS могут проникать через поры AQP1. Барьер свободной энергии проникновения OH и NO ниже, чем у H 2 O 2 и NO 2 , что указывает на то, что эти радикалы могут иметь более легкий доступ к внутренней части поры и взаимодействовать с аминокислотными остатками AQP1.Мы также изучаем эффект индуцированного RONS окисления как фосфолипидов, так и AQP1 (т.е. сульфенилирование Cys 191 ) на транспорт вышеупомянутых RONS через AQP1. Окисление липидов и белков, по-видимому, немного увеличивает барьер свободной энергии для проницаемости H 2 O 2 и NO 2 , тогда как для OH и NO мы не наблюдаем сильного эффекта окисления. Результаты моделирования помогают понять основные механизмы заметного повышения CAP-индуцированного RONS в раковых клетках, тем самым улучшая наше понимание роли AQP в избирательной противораковой способности CAP.

    1. Введение

    В последние годы применение холодной атмосферной плазмы (CAP) для лечения рака показало положительный эффект [1]. Эксперименты уже показали, что CAP может избирательно устранять раковые клетки, оставляя гомологичные нормальные клетки менее поврежденными [2–5]. Эта и другие особенности ВБП, такие как отсутствие боли у пациентов, отсутствие термических и электрических повреждений, а также низкая стоимость [6, 7], могут дать преимущество ВБП по сравнению с традиционными противоопухолевыми методами лечения.

    CAP генерирует активные формы кислорода и азота (ROS и RNS или RONS), e.г., H 2 O 2 , OH, NO, NO 2 и O 3 . Обычно считается, что избирательная противораковая способность CAP связана с более высокими уровнями RONS, которые генерируются в раковых клетках, в то время как нормальные клетки испытывают относительно умеренное увеличение (если таковое имеется) уровней RONS [4, 8–10]. CAP-индуцированные RONS диффундируют через клеточную мембрану, вызывая нитроокислительный стресс в клетке, тем самым влияя на внутриклеточные сигнальные пути и в конечном итоге приводя к гибели клетки [4, 11, 12].Однако лежащие в основе механизмы отчетливого увеличения внутриклеточного RONS все еще полностью не поняты, хотя несколько объяснений уже были предложены в литературе [13-15].

    Одна из теорий, объясняющих избирательный рост внутриклеточного RONS в раковых клетках, основана на трансмембранных белках аквапорина (AQP) [13]. AQP в основном отвечают за транспортировку молекул воды через мембрану, но они также могут проводить другие проникающие вещества (такие как H 2 O 2 , CO 2 и NO) через свои каналы [16, 17].AQP сверхэкспрессируются во многих раковых клетках, включая глиому, гемангиобластому, аденокарциному легких, а также рак гортани, колоректального рака и яичников [18]. Недавние эксперименты с использованием сайленсинга гена AQP8 в клетках глиобластомы привели к снижению токсичности обработанных CAP сред по отношению к этим раковым клеткам [19]. Более того, Miller et al. [20] обнаружили, что экспрессия AQP3 на клетках аденокарциномы толстой кишки HT29, клетках HEK 293 млекопитающих и клетках HeLa рака шейки матки значительно усиливает транспорт H 2 O 2 в этих клетках.На основании этих наблюдений Yan et al. предположили, что CAP-индуцированные RONS могут проникать в раковые клетки значительно быстрее, чем в нормальные клетки, через AQP [13]. Следовательно, эта разница в трансмембранной проницаемости может приводить к более высоким внутриклеточным концентрациям RONS, что приводит к гибели раковых клеток [13, 19].

    Следуя этим соображениям, мы исследуем здесь транспорт RONS через трансмембранный белок AQP с помощью моделирования молекулярной динамики (МД). Кроме того, мы рассматриваем влияние CAP-индуцированного окисления на транспорт этих RONS.Некоторые исследования с использованием моделирования уже были выполнены, чтобы понять механизмы проводимости воды на молекулярном уровне посредством AQP (см., Например, [21–25]). Кроме того, несколько исследований были посвящены проникновению различных неводных растворенных веществ через AQP [26–30]. Кордейро изучал проникновение АФК (в частности, H 2 O 2 , HO 2 и OH) на моделях AQP млекопитающих и растений [31]. Он обнаружил, что все эти виды могут проникать через AQPs с более низкими барьерами свободной энергии по сравнению с таковыми через фосфолипидный бислой (PLB) [31].Мы недавно исследовали транспорт H 2 O 2 через AQP1 [32]. Наше моделирование показало, что проницаемость H 2 O 2 через AQP1 как минимум на два порядка выше, чем через PLB, что указывает на то, что доставка H 2 O 2 внутрь ячейки должна происходить через AQP [32]. Однако общий механизм проникновения RONS через AQP все еще неясен. Более того, не проводилось систематических исследований влияния окисления как PLB, так и AQP на транспорт RONS через AQP.Это, конечно, очень важно для лучшего понимания избирательной противоопухолевой способности CAP, которая производит различные RONS и, таким образом, вызывает окисление, а также для других методов лечения рака, основанных на окислении, таких как химиотерапия, лучевая терапия и фотодинамическая терапия.

    По мере того, как генерируемые CAP RONS достигают клеточной мембраны, ожидается, что некоторые из них попадут во внутриклеточную среду посредством AQP или простой трансмембранной диффузии. Однако как PLB, так и AQP сами являются мишенями для окисления, индуцированного RONS.Вполне возможно, что окисление может изменить свойства PLB и AQP, что, в свою очередь, создает петлю обратной связи по проницаемости RONS. Фактически, эксперименты показали, что проводимость AQP может быть обратимо подавлена ​​при воздействии АФК [33–35]. Было высказано предположение, что прямое окисление AQP или окружающих его фосфолипидов может запускать конформационные изменения, которые приводят к закрытию канала. В таком случае восстановление проводящего состояния будет зависеть от механизмов восстановления клеток. Однако существование механизма окислительного гейтирования еще предстоит продемонстрировать на молекулярном уровне.Также возможно, что в зависимости от природы и степени окисления проницаемость AQP может быть увеличена.

    В этом исследовании мы проводим МД-моделирование для изучения транспорта RONS (в частности, H 2 O 2 , OH, NO 2 и NO) через трансмембранный белок AQP1 с молекулярными деталями, а также эффект окисления как самих PLB, так и AQP1. В частности, мы рассчитываем профили свободной энергии (FEP) RONS для (i) нативного AQP1, (ii) AQP1, окруженного 50% окисленными фосфолипидами, и (iii) AQP1, содержащего окисленные остатки Cys (см. Ниже).

    2. Детали расчета

    Мы выполнили МД моделирование проникновения H 2 O 2 , OH, NO 2 и NO через AQP1. AQP1 является одним из членов семейства AQP и широко экспрессируется в различных раковых тканях, включая рак груди, колоректальный рак, астроцитому, рак яичников, рак шейки матки и рак легких [13]. Мы выбрали вышеупомянутые виды, чтобы включить два гидрофильных (H 2 O 2 и OH) и два гидрофобных (NO 2 и NO) репрезентативных RONS, которые важны при лечении рака ВП [11, 36] .

    Кроме того, мы рассмотрели модель AQP1 в трех возможных состояниях, называемых NAT, OXL и OXP. NAT обозначает нативный AQP1 (pdb id: 1J4N [37]), внедренный в полностью гидратированный бислой нативного пальмитоил-олеоил-фосфатидилхолина (POPC) (см. Рисунки 1 (a), 1 (b) и 1 (d)). Мы выбрали POPC в качестве модельного PLB, потому что он находится в жидком состоянии при температуре, применяемой в наших расчетах [38]. OXL также представляет собой природный AQP1, но окружен эквимолярной смесью природных и окисленных фосфолипидов.Окисленный фосфолипид рассматривался как продукт окислительного расщепления ацильной цепи POPC, что приводит к липидным фрагментам, несущим альдегидную функциональную группу (ALD) (см. Рисунок 1 (d)). Это действительно один из основных продуктов окисления [39]. Он образуется в результате реакции замыкания и размыкания кольца промежуточного липидного перекисного радикала, в результате чего образуются два альдегида. Наконец, OXP состоит из окисленного AQP1 (полученного модификацией Cys 191 каждого мономера до Cys сульфеновой кислоты, т.е.е., Cys-SOH, см. фиг. 1 (a) и 1 (c)), окруженный природным POPC PLB. Таким образом, NAT обозначает модельную систему, содержащую нативных AQP и PLB, тогда как OXL и OXP представляют системы с окисленными липидами или окисленным белком соответственно.


    Как видно из рисунка 1, AQP1 состоит из четырех мономеров, каждый из которых действует как отдельный канал, по которому происходит перенос воды и других растворенных веществ (например, H 2 O 2 и NO).Эти мономеры взаимодействуют друг с другом посредством сил Ван-дер-Ваальса и, следовательно, образуют тетрамерный комплекс. В центре каждого мономерного канала расположены два высококонсервативных мотива Asn-Pro-Ala (NPA), которые обеспечивают селективность в отношении проникновения H + и других ионов [31, 41]. Более того, рядом с внеклеточной частью каждого канала есть область сужения, так называемая ароматическая / Arg (ar / R), которая также способствует селективности. Обратите внимание, что в нашем моделировании положение каждого порового канала было установлено в области NPA (см. Области NPA и ar / R на рисунке 2).Более подробную информацию о структуре AQP1 можно найти в [21, 37, 42, 43].


    2.1. Подготовка модельных систем

    Для создания модельной системы NAT мы применили веб-сервер CHARMM-GUI [44, 45], где ориентация тетрамера AQP1 в окружающей PLB определялась базой данных OPM [46]. Для построения модельной системы OXL мы использовали пакет PACKMOL [47]. Сначала липиды AQP и POPC были упакованы вместе, а затем 50% молекул POPC были заменены липидами POPC-ALD.Наконец, чтобы построить модельную систему OXP, мы модифицировали Cys 191 в каждом мономере NAT-системы на Cys-SOH (Рисунки 1 (а) и 1 (c)) с использованием веб-сервера Viena-PTM 2.0 [48]. Подробное объяснение причины выбора степени окисления 50% в OXL и Cys 191 в качестве окисленной аминокислоты в OXP дано в дополнительной информации. Вкратце, мы использовали 50% -ное окисление в OXL, поскольку оно достаточно велико, чтобы наблюдать эффект окисления. Кроме того, мы выбрали Cys 191 для окисления в OXP, так как он легко окисляется и остается близким к области селективности ar / R.

    Энергия всех модельных систем была минимизирована с использованием алгоритма наискорейшего спуска. Впоследствии они были уравновешены в течение 150 нс в изотермически-изобарическом (NPT) ансамбле при 310 К и 1 атм, применяя термостат Носа-Гувера [49] и полуизотропный баростат Парринелло-Рахмана [50]. Мы проверили, что этого времени уравновешивания было достаточно, так как системы достигли стабильности через ~ 60 нс (см. Дополнительный рис. S1a). Во всех системах противоионы Cl были добавлены к водной фазе, чтобы сохранить электрическую нейтральность системы.Периодические граничные условия применялись во всех декартовых направлениях. Последние 50 нс времени уравновешивания использовались для вычисления средних свойств и для извлечения начальных конфигураций для моделирования зонтичной выборки (US) (см. Ниже). Траектории МД регистрировались с интервалом 20 пс. Моделирование уравновешивания и УЗИ проводилось с шагом по времени 2 фс.

    Мы использовали параметры силового поля GROMOS 54A7 [51] для межатомных взаимодействий в сочетании с моделью воды SPC [52].Кроме того, параметры типа ГРОМОС для RONS, альдегидных продуктов окисленного POPC (т.е. POPC-ALD) и окисленной формы Cys (т.е. Cys-SOH) были получены из [53–55], [56 , 57] соответственно. Во всех расчетах мы использовали границу 1,1 нм как для электростатических, так и для ван-дер-ваальсовых взаимодействий. Мы выбрали это пороговое значение после выполнения серии тестовых прогонов и проверки того, что оно приводит к стабильным структурам белка (ср. Сходимость среднеквадратичных смещений атомов на дополнительном рис.S1a) и PLB с площадью на липид и толщиной, совместимой со справочными экспериментальными данными [58]. Более того, используя это отсечение, мы получили очень похожий FEP H 2 O 2 для собственного AQP1 на наш ранее полученный FEP [32], чего не было в случае с другими радиусами отсечения. Все моделирование и анализ результатов были выполнены с помощью пакета GROMACS 5.1.2 [59], за исключением расчета профилей пор (см. Раздел 2.2). Иллюстрации смоделированных систем были подготовлены с помощью программы VMD [60].

    2.2. Расчет профилей пор

    Мы использовали программу HOLE [61] для расчета профилей пор по AQP1. Мы вычислили средний радиус полости каждой модельной системы по -направлению, то есть направлению, проходящему через поровые каналы (см. Рис. 1 (а) и 1 (б)). Программа движется по плоскостям, перпендикулярным направлению вектора канала (т. Е. -Направлению), и находит самую большую сферу в каждой из этих плоскостей, не перекрываясь с поверхностью Ван-дер-Ваальса любого атома.Используя атомные радиусы Ван-дер-Ваальса AMBER, мы рассчитали окончательный профиль пор для каждой модельной системы (см. Дополнительный рис. S1b) путем усреднения по 250 отдельным профилям пор, полученным из последних 50 нс циклов уравновешивания.

    2.3. Расчет профилей свободной энергии (FEP)

    Мы использовали метод США [62] для расчета FEP для H 2 O 2 , OH, NO 2 и NO по каналам AQP трех моделей. системы, т. е. NAT, OXL и OXP.Чтобы получить средний FEP для каждого проникающего вещества и каждой модельной системы, мы использовали шесть начальных конфигураций, которые были получены из последних 50 нс циклов уравновешивания (то есть при 0, 10, 20, 30, 40 и 50 нс). В каждой модельной системе мы определили 72 зонтичных окна вдоль оси -ос с интервалом 0,1 нм. Таким образом, окна для отбора проб охватывают весь канал от внеклеточных до цитоплазматических водных областей (см. Рисунки 1 (b) и 2). Затем растворенные вещества вводили в центры зонтика, и сдерживающие потенциалы применяли между центром масс растворенных веществ и альфа-атомами углерода областей NPA.Растворенные вещества были ограничены движением вдоль оси α путем приложения гармонического смещения с силовой константой 2000 кДж · моль -1 · нм -2 . Более того, их поперечное движение в плоскости было также ограничено с помощью так называемого ограничения положения с плоским дном с радиусом 0,5 нм и силовой постоянной 500 кДж · моль -1 · нм -2 . Последнее позволило нам вставить четыре растворенных вещества в каждую плоскость (или зонтичное окно), каждое из которых соответствует одной поре (см. Рис. 1 (а)).Во время каждого УЗИ моделировались одновременно шесть зонтичных окон, разделенных расстоянием 1,2 нм. Таким образом, в каждом моделировании в США мы смогли получить результаты для 24 растворенных веществ (например, 24 H 2 O 2 молекул), распределенных по шести слоям вдоль оси -оси (т.е. по четыре растворенных вещества в каждой плоскости). Эта процедура была сделана для экономии времени и ресурсов вычислений, а также для получения достаточной статистики. Обратите внимание, что расстояния между четырьмя растворенными веществами, вставленными в каждую плоскость, были больше порогового значения, поэтому они не взаимодействовали друг с другом во время моделирования УЗИ.Как упоминалось выше, было использовано 72 зонтичных окна или проведено 12 моделирования в США для получения четырех FEP, каждое из которых соответствует одной поре. Таким образом, окончательный FEP каждого растворенного вещества был получен путем усреднения по 24 энергетическим профилям (т. Е.). Аналогичным образом статистические погрешности были получены путем расчета стандартного отклонения между 24 независимо построенными FEP. В целом, для получения FEP было проведено моделирование в США. В целом было выполнено более 1000 симуляций в США, если мы включим тестовые прогоны, выполненные для выбора наиболее подходящего радиуса отсечки (см. Выше).Моделирование в США также проводилось в ансамбле NPT с теми же параметрами, что и при моделировании уравновешивания. Общее время моделирования УЗИ длилось 6 нс, из которых последний 1 нс использовался для сбора гистограмм УЗИ. Все FEP были построены с использованием периодической версии метода анализа взвешенных гистограмм (WHAM) [63] с использованием инструмента gmx wham от GROMACS.

    3. Результаты и обсуждение

    Как упоминалось выше, мы исследуем проникновение как гидрофильных (H 2 O 2 и OH), так и гидрофобных (NO 2 и NO) RONS через поры AQP1 нативного (NAT) и окисленные (OXL и OXP) системы.Результаты среднеквадратичного смещения (RMSD) альфа-атомов углерода AQP1 (см. Дополнительный рис. S1a) показывают, что RMSD во всех системах сходится через ~ 60 нс. Равновесное значение колеблется около 0,32 нм в случае NAT и 0,33 нм в случаях OXL и OXP соответственно. Это небольшое увеличение RMSD указывает на то, что окисленные системы становятся немного более гибкими. Это также можно вывести из среднего профиля пор по каналам AQP1 (см. Дополнительный рис. S1b), поскольку колебания средних радиусов пор в окисленных системах (OXL и OXP) немного выше, чем в естественной (NAT) системе. .Гибкость AQP1 и, следовательно, более высокие колебания радиуса пор в направлении -направлении могут повлиять на проницаемость RONS через AQP1, что действительно наблюдается в нашем моделировании (см. Рисунок 2). Мы видим, что минимальный радиус пор неизменно находится в области сужения ar / R. Полученные радиусы пор составляют, и для систем NAT, OXL и OXP соответственно. Это еще раз указывает на то, что аминокислотные остатки, расположенные в порах, имеют несколько более высокие колебания после окисления и, возможно, могут влиять на селективность области сужения.

    FEP гидрофильных (H 2 O 2 и OH) и гидрофобных (NO 2 и NO) RONS через AQP1 нативной (NAT) и окисленной (OXL и OXP) систем показаны на рисунке. 2. Мы применили трапециевидную поправку к ФЭП, которая позволяет сравнить их с профилями, полученными для ФЭП. Информация о трапецеидальной коррекции приведена в [31].

    Как правило, все проникающие вещества испытывают барьеры при перемещении из внеклеточной водной фазы во внутреннюю часть поры.Степень, в которой окисление липидов (OXL) и белка (OXP) влияет на форму FEP и высоту барьера, зависит от проницаемости. В случае H 2 O 2 барьеры свободной энергии, и регистрируются для NAT, OXL и OXP, соответственно. Окисление, по-видимому, вызывает небольшое увеличение барьера свободной энергии, но различия все еще сопоставимы с пределами неопределенности. В случае NO 2 мы также наблюдаем небольшое увеличение барьера для OXP, но не для OXL.Рассчитанные барьеры свободной энергии равны, и для NAT, OXL и OXP соответственно. Более того, локальный минимум около -0,6 нм исчезает, когда происходит окисление. Для OH и NO мы обнаруживаем либо незначительный (OH), либо нулевой (NO) эффект окисления на энергетический барьер, но это влияет на форму FEP (то есть локальные максимумы и минимумы), что ясно видно для OXL. Для OH барьеры свободной энергии равны, и для NAT, OXL и OXP, соответственно, в то время как для NO эти значения равны, и для NAT, OXL и OXP, соответственно.Следовательно, барьеры свободной энергии для H 2 O 2 и NO 2 несколько выше, чем для OH и NO, что мы связываем с размерами частиц. Важно отметить, что FEP гидрофильных RONS (H 2 O 2 и OH) демонстрируют сходство, т. Е. Их локальные минимумы и максимумы расположены примерно в одних и тех же положениях (наиболее очевидно в случае NAT), и то же самое относится к FEP гидрофобных RONS (№ 2 и NO). Мы должны упомянуть здесь, что из-за высокой реакционной способности радикалов ОН, FEP, полученные из классических нереактивных МД-моделирования, могут только предоставить частичную картину их поведения в AQP, поскольку эти модели не учитывают химические реакции.Тем не менее, все же может быть полезно знать классические барьеры свободной энергии, которые радикалам ОН необходимо преодолеть, чтобы получить доступ к внутренней части поры. Более подробное обсуждение важности FEPs OH дано в дополнительной информации.

    Мы предлагаем качественное объяснение FEP, сосредоточив внимание на энергиях несвязанного (т.е. кулоновского + ван-дер-ваальсового) взаимодействия и профилях радиуса пор, как показано на рисунках 3 и 4 для H 2 O 2 (гидрофильный) и NO 2 (гидрофобный) соответственно.Такой же анализ проводится для радикалов OH и NO и представлен в дополнительной информации (рис. S2 и S3).

    Энергии несвязанного взаимодействия (NBE) вдоль оси -оси рассчитываются между H 2 O 2 и гидрофильными, гидрофобными и амфипатическими аминокислотными остатками AQP1, а также молекулами воды, расположенными внутри и снаружи Поры AQP1. Чтобы облегчить объяснение, мы объединяем профили NBE для гидрофильных остатков с водой (т.е.э., гидрофильный + вода).

    Во всех случаях (например, NAT, OXL и OXP) NBE H 2 O 2 с гидрофильными остатками + вода выше (т.е. более отрицательно), чем с гидрофобными и амфипатическими остатками. Это указывает на то, что гидрофильные остатки + вода вносят больший вклад во взаимодействия. Действительно, H 2 O 2 , являясь гидрофильным веществом, сильно взаимодействует с гидрофильными остатками и особенно с водой, в результате чего наиболее отрицательные значения энергии обнаруживаются во внеклеточных и цитоплазматических водных областях.Кроме того, во всех случаях NBE H 2 O 2 с амфипатическими остатками близки к нулю.

    В системе NAT (рис. 3 (а)) NBE H 2 O 2 с гидрофильными остатками + вода уменьшается (т.е. становится менее отрицательным), когда H 2 O 2 проникает из внеклеточная область к внутренней части поры, что приводит к увеличению барьера свободной энергии (первый ряд рисунка 3). Это только частично компенсируется увеличением NBE с гидрофобными остатками, что приводит к общему ослаблению энергии взаимодействия, что, в свою очередь, может объяснить увеличение свободной энергии.Ограничение, испытываемое H 2 O 2 внутри канала, особенно в области сужения ar / R, создает энтропийный штраф, который отражается на величине свободной энергии. Максимальный барьер свободной энергии наблюдается в области ar / R, что соответствует минимальному радиусу поры (третья строка на рисунке 3). Ближе к концу области ar / R () NBE H 2 O 2 с гидрофильными остатками + вода явно увеличивается (т. Е. Становится более отрицательным), тогда как для гидрофобных остатков он уменьшается, что приводит к общее падение свободной энергии в области NPA.Это также объясняется несколько большим радиусом пор в области NPA, поэтому взаимодействие H 2 O 2 с молекулами воды в поре становится более сильным, а энтропийный штраф ниже. За пределами области NPA () радиус поры немного уменьшается, и NBE H 2 O 2 с гидрофильными остатками + вода снова становится слабее, в то время как NBE с гидрофобными остатками становится сильнее, снова приводя к увеличению свободная энергия. Изменения в NBE здесь более выражены, чем в области ar / R, показывая более сильное взаимодействие H 2 O 2 с гидрофобными остатками и более слабое взаимодействие с гидрофильными остатками + вода.Следовательно, рост барьера при не такой высокий, как в области ar / R.

    Аналогичные интерпретации FEP могут быть сделаны для OXL (Рисунок 3 (b)) и OXP (Рисунок 3 (c)). Единственное отличие состоит в том, что радиусы пор в системах OXL и OXP несколько больше в области сужения ar / R по сравнению с таковым в системе NAT (см. Выше) и имеют более высокие колебания вдоль канала. Это, в свою очередь, влияет на NBE H 2 O 2 (или других проникающих веществ в целом), тем самым влияя на FEP.В случае OXL (рис. 3 (b)), NBE H 2 O 2 с гидрофильными остатками + вода уменьшается более или менее линейно (т.е. становится менее отрицательным) от внеклеточной водной фазы до тех пор, пока NBE с гидрофобными остатками увеличивается (т.е. становится более отрицательным) до этого положения, будучи более или менее постоянным в областях ar / R и NPA. Падение NBE с гидрофильными остатками + вода и ограничение приводят к барьеру свободной энергии, который достигает своего максимума в области NPA около.За пределами этого положения NBE с гидрофобными остатками поднимается (становится более отрицательным), и, следовательно, свободная энергия начинает уменьшаться. Примерно до цитоплазматической области NBE с гидрофильными остатками + вода становится очень сильным, что приводит к падению свободной энергии. Аналогичным образом, FEP случая OXP (рис. 3 (c)) также можно объяснить из NBE H 2 O 2 с гидрофильными остатками + вода и с гидрофобными остатками, как и в случае NAT.

    Интересно отметить, что окисление Cys 191 до сульфеновой кислоты вблизи сужения ar / R делает эту область более гидрофильной. Как и ожидалось, гидрофильные взаимодействия H 2 O 2 в этой области становятся сильнее, а величина свободной энергии уменьшается. Барьер свободной энергии, который первоначально находился в области сужения ar / R в системе NAT, смещен на другую сторону канала, за область NPA, в OXP. Мы предполагаем, что группа сульфеновой кислоты может влиять на тонкий баланс взаимодействия, который поддерживает биполярную ориентацию молекул воды внутри канала (см.[31]). Менее организованный водный файл внутри канала, возможно, может объяснить, почему окисление Cys 191 может влиять на свободную энергию в дистальных областях внутри канала. Хотя аналогичное увеличение барьера свободной энергии наблюдалось в OXP и OXL, механизмы, вероятно, различны. Профили свободной энергии и NBE гораздо менее структурированы в OXL по сравнению с OXP. Хорошо известно, что окисление липидов уменьшает толщину мембраны [64–66], что, в свою очередь, влияет на свойства AQP [67].Мы предполагаем, что изменение толщины мембраны может нарушить структуру AQP и повлиять на организацию водного файла аналогичным образом, как в случае окисления Cys 191 . Заманчиво провести параллель между увеличением барьера свободной энергии, наблюдаемым при окислении, и предполагаемым окислительным блокированием AQP [33–35].

    Мы не даем подробного объяснения FEP гидрофобного NO 2 (см. Рисунок 4), поскольку анализ очень похож на анализ для H 2 O 2 .Мы концентрируемся в основном на различии профилей NBE NO 2 и H 2 O 2 , потому что они помогают объяснить наблюдаемые FEP. Как видно из рисунка 4, самый сильный NBE снова наблюдается во внеклеточных и цитоплазматических водных областях (т.е. около -23 кДж / моль, см. Черную кривую во втором ряду), что соответствует взаимодействию между NO 2 и вода. Обратите внимание, что эта энергия в ~ 5 раз ниже, чем энергия, полученная для H 2 O 2 в этих областях, из-за гидрофобности NO 2 .

    С другой стороны, максимальный NBE с гидрофобными остатками составляет около -17,5 кДж / моль (см. Красную кривую во втором ряду рисунка 4), что всего в ~ 2 раза ниже, чем NBE H 2 O 2 с гидрофобными остатками (см. Фиг. 3). Это указывает на то, что, хотя NBE H 2 O 2 сильнее как с гидрофильными остатками + вода, так и с гидрофобными остатками, по сравнению с NBE NO 2 , взаимодействие NO 2 с гидрофобными остатками относительно прочнее, как и ожидалось, исходя из его гидрофобности.Действительно, глубокий минимум FEP, наблюдаемый в случае NAT (то есть примерно на рис. 4 (а)), обусловлен более сильным взаимодействием NO 2 с гидрофобными остатками по сравнению с взаимодействием с гидрофильными остатками + вода. Этот минимум FEP исчезает в случае OXL и OXP (Рисунки 4 (b) и 4 (c)), скорее всего, из-за более высоких флуктуаций профилей радиуса пор. Остальные характеристики FEP можно объяснить, как это было сделано выше для H 2 O 2 .Аналогичный анализ можно провести и для ФЭП радикалов ОН и NO (см. Рис. S2 и S3).

    Таким образом, в целом рассчитанные профили NBE и радиуса пор помогают объяснить влияние различных типов аминокислотных остатков и молекул воды на FEP RONS. NBE гидрофильных RONS намного сильнее, чем у гидрофобных частиц (см. Рисунки 3 и 4, а также рисунки S2 и S3). Для гидрофильных частиц (H 2 O 2 и ОН) вклады NBE гидрофильных остатков + вода в общие взаимодействия выше, чем вклады гидрофобных остатков.Аналогично, для гидрофобных частиц (NO 2 и NO) вклад гидрофобных остатков в общую энергию NBE выше, чем вклад гидрофильных остатков + вода.

    Следует отметить, что центральная полость тетрамера AQP (см. Рис. 1 (а)) также может играть роль в транспортировке RONS внутрь клетки. Однако мы не учитываем вклад центральной полости, поскольку наши предыдущие исследования показали, что полученные барьеры свободной энергии для гидрофильных частиц (OH и H 2 O 2 ) через центральную полость намного выше, чем через отдельные поры. [31, 32].Эти барьеры либо аналогичны, либо выше, чем те, которые рассчитаны в исходном PLB. Таким образом, весьма вероятно, что гидрофильные частицы, скорее всего, проникают через поры, даже когда происходит окисление липидов или белков, поскольку они испытывают более низкие барьеры свободной энергии. С другой стороны, гидрофобные частицы (NO и NO 2 ), скорее всего, предпочитают транспорт через PLB, поскольку они испытывают значительно низкие барьеры проникновения (т.е. ~ 1 кДж / моль) [55]. Эти барьеры незначительны по сравнению с барьерами через поры AQP, полученными в этом исследовании с использованием окисления как липидов, так и белков.

    Наконец, следует также упомянуть, что настоящие клеточные мембраны намного сложнее, чем простые модели мембран, рассматриваемые здесь. Клеточные мембраны состоят из сложной смеси липидов и встроенных мембранных белков, которые способны сегрегировать и образовывать гетерогенные домены в нанометровом масштабе. Экспрессия мембранных белков, таких как AQP, является предметом сложных механизмов регуляции, которые, как ожидается, также будут играть роль в клеточном ответе на окислительный стресс.Имея это в виду, эффекты окислительного стресса на проницаемость AQP, выявленные в результате моделирования, следует рассматривать как часть более крупного и сложного биохимического механизма.

    4. Выводы

    Целью нашего исследования было лучше понять процесс проникновения как гидрофильных (H 2 O 2 и OH), так и гидрофобных (NO 2 и NO) RONS через поры AQP1. , который является трансмембранным белком, а также эффект окисления липидов и белков, который может быть вызван этими RONS.

    Наши результаты показали, что окисление одного остатка Cys 191 в каждой поре AQP1 (т.е. окисление белка) оказывает почти такое же влияние на барьер свободной энергии H 2 O 2 , как и 50% окисление липидов. в PLB. Для ОН и NO барьер в случае окисления белка даже немного выше, тогда как в случае NO 2 он явно выше, чем при 50% окислении липидов. В целом окисление липидов и белков влияет на форму FEP всех RONS, а также на высоту барьера для H 2 O 2 и NO 2 .В целом барьеры свободной энергии для H 2 O 2 и NO 2 несколько выше, чем для OH и NO, что мы отнесли к размерам этих частиц.

    Чтобы объяснить FEP, мы изучили NBE RONS с гидрофильными и гидрофобными аминокислотными остатками и водой, обнаруженными как внутри, так и снаружи пор, а также профили радиуса пор. Они помогают объяснить форму FEP, показывая аминокислотные остатки и молекулы воды, участвующие в процессе проникновения.

    Результаты нашего моделирования показывают, что в целом окисление не оказывает сильного влияния на транспорт RONS через AQP. Тем не менее, мы отмечаем, что обычное МД-моделирование неспособно уловить крупномасштабные структурные изменения белков, которые происходят за пределами многомикросекундной временной области. Поскольку барьер для транспорта гидрофильных RONS через AQP (как природных, так и окисленных) довольно низок (~ 6-12 кДж / моль), мы предполагаем, что эти частицы (т.е. OH и особенно H 2 O 2 ) будут проникают в клетку через AQP, поскольку они испытывают явно более высокий барьер через PLB (~ 15-30 кДж / моль) [32, 53, 65], особенно у нативных (т.е.е., без перемешивания) липидный бислой. С другой стороны, гидрофобные RONS (то есть NO, NO 2 , но также и другие, такие как O 2 ), скорее всего, проникают через PLB, где может происходить (пер) окисление липидов, поскольку их барьер через AQP выше (т.е. ~ 5-12 кДж / моль против ~ 1 кДж / моль для PLB [55]).

    Наши результаты обеспечивают понимание на молекулярном уровне процессов проникновения RONS через мембрану и, в частности, роли AQP, который часто больше экспрессируется в раковых клетках.Это может помочь улучшить наше понимание избирательного повышения RONS, наблюдаемого в раковых клетках, проливая свет на избирательный противораковый механизм CAP.

    Доступность данных

    Данные, использованные для подтверждения выводов этого исследования, можно получить у соответствующего автора по запросу.

    Конфликт интересов

    Авторы заявляют об отсутствии конфликта интересов в отношении публикации этой статьи.

    Выражение признательности

    Авторы выражают признательность за инфраструктуру высокопроизводительных вычислений Тьюринга на базовом объекте CalcUA Университета Антверпена (UA), подразделение Фламандского суперкомпьютерного центра VSC, финансируемого Фондом Геркулеса, правительством Фландрии (департамент EWI) и UA, где выполнялись все вычислительные работы.