Кузов фургон к 66: Кузов-фургон типа К66Н на шасси автомобиля ГАЗ-66. ТО и ИЭ.

Содержание

Типовые кузова-фургоны. Автомобили Советской Армии 1946-1991

Типовые кузова-фургоны

Одними из наиболее распространенных военных надстроек на шасси ГАЗ-66 были многочисленные обитаемые кузова-фургоны различных видов, конструкций и назначения, выпускавшиеся специализированными предприятиями. В разное время на них устанавливали прямоугольные деревометаллические фургоны КУНГ-2М производства объединения «Газстроймашина», каркасно-металлические КУНГ-66 и модернизированные округлые конструкции АВС-2М с трапецевидными колесными нишами. С середины 1960-х годов роль основных армейских фургонов стали играть типовые кузова К-66 и КМ-66 с расположением запасного колеса на заднем откидном кронштейне, специально разработанные для установки на ГАЗ-66 разных версий. Они полностью удовлетворяли военным требованиям по универсальности, габаритам, собственной массе, прочности, уровню безопасности, приспособленности к перевозке различными средствами транспорта и использованию внешних или автономных источников энергии, возможности эффективной эксплуатации в военных действиях и при наиболее суровых дорожных или климатических условиях.

Кузова обеспечивали размещение разнообразного оборудования, оснащения или имущества, а также долговременное пребывание в них людей с созданием для них всех необходимых условий для эффективной деятельности и отдыха. На последнем этапе выпуска ГАЗ-66 для перевозки на бортовых грузовиках были разработаны типовые съемные кузова-контейнеры КК-1.1 и их удлиненные версии КК-2.2 универсального назначения.

Штабная машина Внутренних войск Р-125МТ2 в кузове АВС-2М на шасси ГАЗ-66-05. 1966 год.

К-66 – серия наиболее распространенных обитаемых бескаркасных кузовов-фургонов для ГАЗ-66. Их первоначальная конструкция была разработана в 1958 – 1960 годах на заводе № 38. С учетом возросших требований к такой технике Министерство обороны в апреле 1967 года приняло новые «Тактико-технические требования на разработку семейства унифицированных кузовов-фургонов из армированного полистирольного пенопласта для автомобилей, прицепов и полуприцепов», дальнейшее проектирование которых было возложено на кузовной отдел Всесоюзного проектно-конструкторского и технологического института мебели (ВПКТИМ) Минлесдревпрома СССР.

С 1968 года их изготовлением занимались Шумерлинское предприятие ШЗСА, Козловский и Красногорский комбинаты автофургонов, а также ряд целлюлозно-бумажных и деревообрабатывающих комбинатов.

ГАЗ-66-04 с низкопрофильным обитаемым бескаркасным кузовом-фургоном К-66Н. 1967 год.

Типовые кузова К-66 имели плоские передние, боковые и задние панели из армированного пенопласта, центральную часть крыши с характерными плоскими скосами, короткие надколесные ниши и заднюю двухстворчатую дверь размерами 1305×1570 мм с узким окном. Они были приспособлены к эксплуатации при экстремальных температурах, использованию электросети напряжением 220 или 380 В или бортового 12-вольтового источника питания, снабжались отопителем ОВ-65Б и фильтровентиляционной установкой ФВУ-100Н-12. Кузова К-66 выпускались в четырех модификациях с разными габаритами, внутренним объемом и степенями прочности, количеством и расположением окон, дверей и люков. В них монтировали оборудование многочисленных военных средств связи, машин управления и мастерских разного профиля.

Самым востребованным был высокий вариант К-66В с полезной нагрузкой 1230 кг, рабочей площадкой на крыше и 12 окнами-люками – по три в боковых стенках и по три световых люка в скосах крыши. Его снаряженная масса составляла 1280 кг. Внутренняя длина – 3680 мм, ширина – 2250 мм, высота в центральной части – 1800 мм, по боковой стене – 1500 мм. Погрузочная высота – 1190 мм. Габаритные размеры автомобиля ГАЗ-66 без лебедки с кузовом К-66В – 6029x2400x3160 мм. Полная масса автофургона без лебедки – 4300 кг, с лебедкой – 4470 кг. Второй высокий вариант
К1-66
снабжался только правой боковой дверью, двумя окнами на каждом скосе крыши и внутренним переговорным устройством. В войсках машины с такими кузовами использовали в качестве автобусов для доставки 19 человек на индивидуальных сиденьях. В низкопрофильном малогабаритном кузове К-66Н с полезной нагрузкой 1460 кг и внутренней высотой 1430 мм обычно монтировали более компактное оборудование связи. Его вариантом являлся фургон К-66ДС на десантируемом шасси ГАЗ-66Б. В программу входили также удлиненные варианты К-66У1Д и К-66У1-ДП повышенного внутреннего объема, которые устанавливали в основном на автомобили ЗИЛ-157.

КМ-66 – серия более прочных и тяжелых каркасно-металлических (цельнометаллических) кузовов с полезной нагрузкой 1230 кг для монтажа оборудования полевых мастерских, унифицированных по габаритам с серией К-66. Кузов КМ-66 был разработан в 1964 году и выпускался до 1975 года военным заводом п/я 4111, который впоследствии стал известен как Московский завод специализированных автомобилей (МЗСА). С 1970 года его собирал Козельский механический завод Калужской области, затем Львовский механический завод и с 1978 года – Энгельсский завод специализированных автомобилей (ЭЗСА). По сравнению с кузовами К-66В внутренняя длина КМ-66 достигала 4000 мм. Низкопрофильный складной вариант

КМ-66ДС предназначался для авиадесантируемого автомобиля ГАЗ-66Б.

КУНГ-66 – многоцелевой каркасно-металлический кузов второго поколения для целевой установки на ГАЗ-66. В 1977 – 1983 годах его собирал Козельский мехзавод. Боковые стенки кузова были утеплены пенопластом и изнутри облицованы древесноволокнистыми плитами, пол на пенопластовой прокладке покрыт фанерными листами. В транспортном положении под ним помещался съемный задний трап. В отличие от кузова КУНГ-2М он снабжался отопительно-вентиляционной установкой ОВ-65Б и фильтровентиляционной ФВУА-100.

ГАЗ-66 с кузовом КШ-66 повышенной прочности, разработанным в 21 НИИИ. 1977 год.

К наиболее оригинальным экспериментальным конструкциям относились специальные «сверхобтекаемые» кузова-фургоны Опытного завода № 38, разработанные конструкторами 21 НИИИ. В 1965 – 1967 годах там были созданы макетные образцы округлых стеклопластиковых кузовов КЗ-1, за которыми в 1972 – 1977 годах последовал кузов повышенной прочности (КПП) КШ-66 с интегрированной кабиной. Их подчеркнуто обтекаемые формы, близкие к шарообразной, предопределяло принятое в то время направление на создание военных машин, стойких к поражающим факторам оружия массового поражения. По сравнению с типовыми металлическими кузовами их сопротивляемость к воздействию ударной волны ядерного взрыва оказалась втрое выше.

Данный текст является ознакомительным фрагментом.

Продолжение на ЛитРес

Регистрация смены типа кузова ГАЗ 66 | [email protected]

Данные о транспортном средстве:

🚛ГАЗ 66

📍Камчатский край

📋Список зарегистрированных изменений

✅Устанавливается кузов-фургон (КУНГ) взамен бортовой платформы.

ГАЗ-66 — советский и российский грузовой автомобиль с колёсной формулой 4 × 4. Наиболее массовый полноприводный двухосный грузовик в Советской Армии ВС СССР и в народном хозяйстве СССР и России в 1960—1990-е годы. В народе получил прозвания «Шишига» и «Шишка» по созвучию с номером 66. Всего был выпущен 965 941 экземпляр.

Сегодня Шишига уже реже встречается на службе в армии и народном хозяйстве, но благодаря отличным внедорожным качествам и простоте конструкции, автомобиль по прежнему любим и остается в собственности у многих автомобилистов.

ГАЗ 66 отлично подходит для охоты, рыбалки и в целом для труднопроходимых маршрутов. Поэтому смена типа кузова довольно частая процедура у собственников этого автомобиля. Многие оборудуют целые автодома, устанавливая для этого вместо бортовой платформы кузов-фургон (кунг).

Однако смена типа кузова является изменение конструкции ТС и требует обязательной регистрации в ГИБДД. Не зарегистрировав изменения – эксплуатация транспортного средства запрещена законом и влечет санкции для собственника.

Владелец данного ГАЗ, не желая иметь проблемы с сотрудниками, обратился в Центр переоборудований Некст, чтобы узаконить доработки автомобиля.

Описание работ

  • Демонтировать штатную бортовую платформу.
  • Произвести предварительную разметку и позиционирование мест крепления кузова-фургона (КУНГа)
  • На лонжероны установить КУНГ, надежно закрепив крепежными элементами.

Требования к конструкции

  • Изменение типа кузова, связанное с установкой на шасси транспортного средства стандартного#nbsp; кузова-фургона (КУНГа), прошедшего оценку соответствия в составе данного типа транспортного средства ( п. 1 Приложения № 9 ТР ТС 018/2011).
  • Максимальная масса и ее распределение по осям и бортам, а также изменение координат центра масс не должны превышать пределов, установленных изготовителем транспортного средства ( п. 1.1 Приложения № 9 ТР ТС 018/2011).
  • Габаритная ширина не должна превышать 2,55 м, а высота 4,0 м.( п. 1.2 Приложения № 9 ТР ТС 018/2011).
  • КУНГ должен надежно крепиться к раме транспортного средства крепежными элементами, аналогичными по конструкции, количеству и материалу элементам крепления кузова или цистерны того же транспортного средства, изготовленного в условиях серийного производства, той же или большей технически допустимой максимальной массы (п. 1.3 Приложения № 9 ТР ТС 018/2011).
  • Место расположения и установка задних внешних световых приборов и приборов освещения заднего государственного регистрационного знака должны соответствовать Правилам ООН N 48 (п. 1.4 Приложения № 9 ТР ТС 018/2011).
  • На ТС должны быть предусмотрены места для крепления регистрационных знаков в соответствии с требованиями (п. 4 Приложения № 7 ТР ТС 018/2011).

Необходимо зарегистрировать изменения ТС – обращайтесь за консультацией на горячую линию#nbsp;+7 (800) 100 84 55. Работаем по всей России!

Грузовик ГАЗ 66 – полная характеристика автомобиля. Технические параметры, Габаритные размеры. Отзывы владельцев

Тип авто

Бортовой автомобиль
Колесная формула 4×4
Полная масса авто, кг 5770
Полная масса автопоезда, кг 7770
Допустимая нагрузка на переднюю ось , кг 2715
Допустимая нагрузка на заднюю ось , кг 3055
Грузоподъемность, кг 2000

Площадь платформы, м2

нет данных

Объем платформы, м3

нет данных
Масса снаряженного авто, кг 3440
Максимальная скорсть (км/ч) 90
Двигатель ЗМЗ-66-06
Мощность двигателя (л. с.) 115
Коробка передач механическая, четырёхступенчатая. передаточные числа 1. 6,55. 2. 3,09. 3.1,71. 4. 1,00. ЗХ 7,77. Раздаточная коробка 1. 1,98. 2. 1,00
Число передач 4
Передаточное число ведущих мостов нет данных
Подвеска Зависимая: передняя и задняя на полуэллиптических рессорах с амортизаторами, концы коренных листов установлены в резиновых подушках опорных кронштейнов
Размер шин 12,00 – 18 специальные
Топливный бак 210
Кабина двухместная, расположена над двигателем, откидывается вперед, оборудована местами крепления ремней безопасности и спальным местом
Екологический тип Euro-0

Кузов универсальный – Основные средства

М. Гарви

Странно звучащее сегодня слово «КУНГ» еще сравнительно недавно было знакомо если не каждому, то каждому второму жителю Советского Союза: армейская аббревиатура, означающая «кузов универсальный», который представляет собой по большому счету милитаризованный вариант пассажирского изотермического фургона.

Своим появлением КУНГ обязан Советской Армии. Еще в 30-е годы никто не сомневался, что предстоящая война станет войной моторов. Но тогда армейские специалисты оказались просто не способными оценить все последствия этого простого и очевидного постулата. Но сразу после второй мировой жизнь сама все расставила по местам. Во-первых, появилось огромное количество сложной и привередливой техники – например, радиолокационные станции, ракетные комплексы, средства дивизионной и армейской радиосвязи. Заметьте, в глазах генералов грош ей цена, если она не способна передвигаться вместе с войсками.

Но при этом в чистом поле или палатке такие устройства не смонтируешь, а работающие с ними люди должны находиться в сравнительно комфортных условиях. Да и возможность применения «предполагаемым противником» ядерного оружия заставляла принять меры. Вот и родился на свет в качестве вместилища аппаратуры и рабочих мест «кузов универсальный» или КУНГ. По части последней буквы эксперты, к которым мы обратились за консультацией, во мнениях разошлись, но наиболее вероятной расшифровкой КУНГ мы склонны считать словосочетание «кабина универсальная герметизированная».

Уже в 60-е годы потребности армии в таких кузовах стали огромными. В них монтировали дизель-генераторные установки, аппаратуру станций наведения ракет, локационные и радиостанции, контрольно-испытательные станции, размещали передвижные ремонтные мастерские; их даже использовали в качестве автобусов. Строили их по стандартной документации в самых разных количествах на многих заводах, некоторые из которых мы здесь упомянем.

Наиболее известные сегодня КУНГи, представляющие собой будки с прямоугольными стенками и полукруглой крышей, появились в нашей стране в 1958 г. Эти кузова – КУНГ-1М, имеющие в задней стенке одно- или двустворчатую дверь, как правило, снабженную окошком, устанавливались на шасси ЗИЛ-157, -157К, -157КД, -157КЕ. Собственно кузов представлял собой деревянный каркас, обшитый гладким стальным листом снаружи и фанерой внутри. Между обшивками вкладывался теплоизолятор – войлочная или паклевая набивка, а в более позднее время – стекловата, поролон, пенопластовая плита или древесно-стружечный наполнитель. В зависимости от назначения на бортах, в нижней части, имелись специальные люки. В некоторых версиях они занимали всю длину кузова.

Во всех случаях кабины снабжались фильтро-вентиляционными установками, создававшими внутри избыточное давление и не позволявшими попасть внутрь радиоактивной пыли, если таковая появится. Двери, также как и крышки люков, подгонялись к проемам довольно точно, так что кузова эти были действительно «герметичными».

Такие кузова оснащались принудительной вентиляцией, индивидуальным обогревом (электропечь) или обогревом за счет выхлопных газов двигателя, направляющихся по особым трубам, проложенным под полом кузова или в его передней стенке. Имелась и система отопления – чаще всего независимые бензиновые подогреватели (между прочим, более практичные, чем предпусковые, ставившиеся на автомобили) и электрические калориферы. Но встречались и тривиальные печки – «буржуйки».

Первыми разработчиками таких кузовов было СКБ Газстроймашина, (Москва). Изготавливали их поначалу два завода – Львовский механический и Московский ремонтно-механический и стройдеталей.

Позднее, когда на ГАЗе и ЗИЛе началось производство грузовиков нового поколения, Газстроймашина разработала кузова и для них: КУНГ-2М для ГАЗ-66-02 и КУНГ-1ММ для ЗИЛ-131. Они строились с 1967 г. на тех же предприятиях. КУНГ-2М вмещал до 8 человек, а КУНГ-1М и КУНГ-1ММ – до 12. Габариты оснащенных кузовом-кабиной автомобилей (длина х ширина х высота, мм) составляли: для ГАЗ-66-02 5 655х2 342х3 180 или 5 600х2 300х3 180 , 7 550х2 450х3 200 или 7 250х2 490х3 318 для ЗИЛ-157, -157К, -КЕ, -КД и 7 250х2 490х3 320 для ЗИЛ-131.

Для «шестьдесят шестого» с 1970 г. Козельский механический завод выпускает КУНГ К-66, аналогичный КУНГ-2М. Кабины этого типа оснащаются отопительно-вентиляционной установкой ОВ-65Б и фильтро-вентиляционной установкой ФВУА-100. Они имеют металлический каркас и наружную облицовку из стального листа. Пол также стальной, но покрыт фанерой, с прокладкой из пенополиуретана (пенопласта). Боковые стенки кузова утеплены пенопластом и облицованы изнутри оргалитом (ДВП). Задний навесной трап в транспортном положении крепится под полом кузова сзади.

Некоторое количество автомобилей с КУНГами попадало и в гражданские организации – главным образом к геологам, в топливно-энергетический комплекс и к строителям. Естественно, фильтро-вентиляционных установок на такие кузова не ставили, а о наличии подходящей аппаратуры приходилось заботиться самому клиенту. Правда, армейские КУНГи оказались на изумление крепкими; списание обернулось для них «дембелем», и многие из этих кузовов, благополучно переживающих десятого-двадцатого «носителя» можно встретить и поныне на машинах с гражданскими номерами.

Выпускаются КУНГи с крышей- «сундучком» и сегодня. Их делают на Львовском механическом и Козельском механическом заводах. Они устанавливаются на шасси ЗИЛ-131/131Н, 433420, 433430, 433450 и обозначаются К-131, К-131Н, К-433, КМ-131, КМ-131Н.

Трехосные полноприводные автомобили «Урал-375» также получили «универсальный кузов» сразу, как только встали на конвейер – в 1961 г. Естественно, монтировавшийся на них КУНГ теплоизолирован, имеет внутреннее освещение, снабжен отопительно-вентиляционной и фильтро-вентиляционной установками. Выпускался он самим «УралАЗом» под маркой КМ-500, и с незначительными изменениями перекочевал и на более новые модели: «Урал-4320» и «Урал-4320-10».

Мощные грузовики Кременчугского завода также снабжались «кузовами-кабинами», в изготовлении которых первую скрипку играли Кременчугский механический и Козельский механический заводы. По оснащению и конструкции их КУНГи идентичны рассмотренным ранее.

Козельский завод начал выпуск КУНГов КМ-500, аналогичных уралазовским – с 1977 г. для «Урал-4320», а с 1979-го для КрАЗ-260 и КамАЗ-4310/43105. Это цельнометаллический кузов с горизонтальной средней и наклонными боковыми частями с окнами. Размеры фургона-КУНГа – 4 500 х 2 500 х 1 800 мм. Он оснащен отопительно-вентиляционной установкой и вмещает до 12 человек.

За последнее десятилетие популярность КУНГов сильно уменьшилась: армейские заказы схлопнулись, а для перевозок грузов гораздо удобнее и дешевле пользоваться обычными фургонами. Однако спрос на такие кузова сохраняется и в условиях рынка, ибо все, что монтировалось в такие кабины, за исключением вооружения, оказалось очень полезным и в гражданской жизни. Более того, после «дембеля» число профессий КУНГов неизмеримо выросло.

С 1980 г. АО «МордорМаш» (Саранск) выпускает удлиненный цельнометаллический кузов с отопительно-вентиляционной установкой ОР-305А, который может служить передвижной самоходной мастерской. Устанавливается на шасси: КамАЗ-5320/53212 и «Урал-4320».

Шумерлинский завод специализированных автомобилей выпускает КУНГи с 1960 г. Наиболее яркий пример его продукции мастерская МТО-АТ-М1 (ЗИЛ-131 и ЗИЛ-4334). Предприятие выпускает также кузова К-66, К-66Н, К-6Г для ГАЗ-66-40 и ГАЗ-33097/3308 «Садко»; на шасси КамАЗ-4310, «Урал-4320» и «Урал-6361» монтирует кузов-кабину К4. Изготавливают здесь и двухосные прицепы-кабины К-11/К-11Г/К-10Г на шасси СМЗ-782Б и СМЗ-8325, а также КП4, К1П4 и К2П4 на шасси СЗАП-8357/83571 или же на санях. На заказ ставят КУНГи на шасси любых отечественных грузовых автомобилей, прицепов и полуприцепов.

Кузов-кабину ВНГ-21М на шасси «Урал-4320» выпускает Волжский машиностроительный завод (Рыбинск) с 70-х годов. В потолке кузова размещен трехтонный грузоподъемник с электрическим и ручным приводом, обеспечивающий подъем, опускание, продольное и поперечное перемещение груза. Имеется система приточно-вытяжной вентиляции, фильтро-вентиляционная установка, отопитель и средства пожаротушения.

КУНГи для всех полноприводных версий ЗИЛ (6х6) выпускает Энгельсский завод специализированных автомобилей с 1966 г. Их кузова имеют каркасно-панельную конструкцию, скошенные боковины крыши. Каркас металлический. Термоизоляция – пенопластовая. Одна задняя дверь, два люка, отопитель и фильтро-вентиляционная установка. Идентичный ему выпускается АО «Ижмаш» с 1966 г.

Вездеход ЗИЛ-4972 (6х6), оснащенный КУНГом со скошенными верхними боковыми стенками (по 4 окна в каждой стороне) выпускается на ЗИЛе с конца 90-х годов. Его габариты аналогичны уралазовскому.

Вахтовки, основой которых послужили КУНГи со скошенными боковинами крыши, изготавливают ЗАО «Уральский автомоторный завод» и ОАО «Волжский машиностроительный завод». Монтируются эти кузова на трехосные полноприводные ЗИЛы с конца 90-х годов.

Правдинский завод радиорелейной аппаратуры на шасси ЗИЛ-497200 ( 6 х 6) с равноудаленными осями выпускает КУНГ с габаритами – 8 700 х 2 480 х 3 250 мм, в зависимости от комплектации 10 – 20 мест. КУНГ выпускается с конца 90-х годов. Он – аналог зиловскому.

В заключение расскажем о еще одном применении «демобилизованных» армейских кабин. Из них получаются замечательные пункты управления, передвижные офисы и даже просто кемперы. Направление это сегодня выглядит настолько перспективным, что на «УралАЗе» даже создали специальный передвижной офис с раздвижными стенами.

Необычные варианты “шишиги”. Часть 1: ГАЗ-66-16

Грузовики серии ГАЗ-66 (в лице базовых моделей ГАЗ-66-01 и ГАЗ-66-11) на протяжении четверти века имели грузоподъемность в 2 тонны. Для военных нужд такая нагрузка была достаточной, а вот для народного хозяйства – не всегда. Преемником ГАЗ-66 должен был стать новый ГАЗ-3301, способный возить уже 2,5 тонны. Однако к концу 1980-х, пройдя все этапы испытаний и согласований, это проект «забуксовал». Как мы знаем, Министерство обороны так и не выделило средств на освоение этой машины. Тем не менее, она оказала заметное влияние на дальнейшее развитие семейства ГАЗ-66.

Когда проект ГАЗ-3301 еще не был закрыт, на Горьковском автозаводе был принят к исполнению документ, который именовался как «Комплексная программа повышения качества и технического уровня автомобиля ГАЗ-66-11 на 1988-1990 годы». Он предусматривал модернизацию серийной «шишиги» за счет внедрения узлов и агрегатов от ГАЗ-3301 с той целью, чтобы в перспективе перейти на выпуск грузовиков нового поколения в более сжатые сроки. Попутно появлялась возможность решить одну застарелую проблему. Дело в том, что грузоподъемность автомобилей семейства ГАЗ-66 на уровне 2 тонн (для бортового автомобиля) была недостаточной для некоторых видов надстроек: их монтаж вызывал перегрузку машины на 250-300 кг. Например, к числу таких избыточно тяжелых надстроек относился хорошо известный армейский кузов-фургон К66. А внедрение узлов от ГАЗ-3301 позволяло пойти на официальное увеличение полезной нагрузки «шишиги».

 

” />

ГАЗ-3301 в 1988 году считался перспективной моделью, которая не сегодня – завтра встанет на конвейер взамен ГАЗ-66

 

Результатом работ в этом направлении стало появление автомобиля ГАЗ-66-16. Мало отличаясь внешне от базовой модели ГАЗ-66-11, «шестнадцатая» модификация получила множество локальных доработок практически во всех узлах и агрегатах, что позволило «подтянуть» технические характеристики и повысить надежность машины в целом. Что именно изменилось? Величина полезной нагрузки была увеличена до 2,3 тонн, что позволило расширить перечень гражданских надстроек, пригодных для монтажа на это шасси. С учетом перспективы снижения гособоронзаказа, это было актуально. Возможность увеличения полной массы подкреплялась усилением рамы и подвески (внедрили рессоры прямоугольного профиля и резиновые отбойники заднего моста).

 

” />

 

 

Для сохранения необходимых тягово-динамических показателей ГАЗ-66-16 получил модернизированный двигатель ЗМЗ-513.10, отдача которого была увеличена до 125 сил. В свою очередь, более мощный двигатель потребовал применения усиленных ведущих мостов: с балками и редукторами типа ГАЗ-3301, задними полуосями увеличенного диаметра и локальными усилениями отдельных деталей – сепараторов дифференциала, фланцев ступиц, упорных шайб и т.д. Коробку передач тоже пришлось усилить за счет внедрения шестерни I передачи и блока шестерен заднего хода из стали 35ХМ вместо прежней 35Х и более износостойкой вилки. Стала эффективнее тормозная система: в ней появились гидровакуумные усилители большей размерности (от ГАЗ-3307) и стояночный тормоз с вилочным разжимом. Изменилась трасса прокладки магистралей тормозной системой и системы подкачки шин, чтобы исключить возможность вредных контактов.

 

” />

ГАЗ-66-17 – модификация усиленной шишиги с лебедкой

 

В выпускной системе использовали глушитель новой конструкции, обеспечивающий снижение уровня внешнего шума. Наконец, на ГАЗ-66-16 с ГАЗ-3301 перекочевала новая платформа с ровным полом и деревянным настилом. Она обладала более высокой универсальностью за счет увеличенных внутренних размеров и отсутствия надколесных ниш. Кроме того, в полу у нее имелся люк для облегчения демонтажа раздаточной коробки. Кстати, из-за большей ширины новой платформы потребовалось увеличить вылет кронштейнов зеркал заднего вида на 50 мм, иначе теперь в них мало что было видно.

 

” />

 

В феврале 1989 года «экспериментальщики» Горьковского автозавода собрали три опытных образца модернизированных «шишиг»: базовую модель ГАЗ-66-16 (шасси № Э-6680), версию с лебедкой ГАЗ-66-17 (шасси № Э-6682) и модификацию с экранированным электрооборудованием и лебедкой ГАЗ-66-19 (шасси № Э-6681). После заводских и приемо-сдаточных испытаний они поступили в распоряжение госкомиссии для проведения междуведомственных испытаний, которые должны были решить судьбу новой разработки горьковчан. С апреля по ноябрь все три грузовика активно «гоняли» в разных климатических условиях и по дорогам самой разной степени убитости, включая специальные дороги заводского полигона в Березовой Пойме. Основной пробег одной из машин пришелся на грунтовки Горьковской и Ивановской областей, два других грузовика ездили в Среднюю Азию для проверки надежности в условиях жарко-пустынной и высокогорной местности. Стартовав из Горького, они сделали круг протяженностью 10,5 тысяч километров через Уральск, Чимкент, Ош, Самарканд, Ашхабад и Баку.

 

” />

 

Советские автомобили нечасто заканчивали государственные или приемочные испытания с негативными отзывами. Однако с ГАЗ-66-16 это был как раз тот самый случай. Качество сборки советских автомобилей к концу 1980-х сильно упало, это ни для кого не является секретом. Вот и модернизированные «шишиги» показали себя на испытаниях не лучшим образом, часто ломаясь. Многие отказы касались стандартных, серийных узлов и деталей. Больше всего нареканий пришлось на двигатели (имели место даже прогары поршней и задиры на гильзах цилиндров), карданные валы, детали подвески, шины, гидроусилитель руля и буксирный прибор. Кроме того, из-за возросшей массы у ГАЗ-66-16 при сохранении прежних диагональных шин К-70 ухудшались показатели опорной проходимости: глубина оставляемой автомобилем на бездорожье колеи выросла, а тяговые показатели, соответственно, снизились.

 

” />

В качестве оппонента модернизированных шишиг к междуведомственным испытаниям привлекли также обычный ГАЗ-66-11

 

В этой связи заводу пришлось делать «работу над ошибками» и претворять в жизнь комплекс мер по повышению качества, связанных главным образом с внедрением более строго контроля качества изготовления техники. В результате в феврале 1990-го были собраны еще три опытных образца грузовиков для дополнительных межведомственных испытаний: два ГАЗ-66-17 (шасси № Э-6685 и Э-6686) и один ГАЗ-66-19 (№ Э-6684). На двух из них дополнительно были внедрены новый держатель “запаски”, радиатор с уменьшенным верхним бачком, необслуживаемый аккумулятор, рабочие тормозные цилиндры с дополнительным кольцом. Кроме того, в разное время на этих грузовиках были опробованы три новых варианта шин: модернизированные диагональные К-70М1 и К-70М2, а также радиальные КИ-115 размерности 12,00–18.

 

” />

ГАЗ-66-17, разбитый в ДТП во время междуведомственных испытаний

 

Повторные испытания продлились с марта по октябрь 1990 года и на сей раз завершились успешно. Наработка на отказ составила достаточные для удовлетворительной оценки 22 тысячи километров, а перечень более-менее серьезных неисправностей ограничился подшипником коробки передач (разрушился на одной машине) и течами некачественных шлангов гидроусилителя руля. Правда, до финала испытаний из трех «шишиг» дожили лишь две, но не по собственной вине. Дело в том, что 26 августа 1990-го один из двух ГАЗ-66-17 попал в серьезное ДТП в районе Волгограда. Груженая «шишига» с прицепом двигалась по трассе со скоростью около 40 км/ч, когда в лоб ей на высокой скорости вышла «девятка» с дагестанскими номерами. Вот как тут не вспомнить об аналогичном случае на испытаниях опытной «ГАЗели»!

 

” />

Лонжероны рамы от удара сломались и выгнулись буквой Г

 

 

Удар был с минимальным перекрытием и первично пришелся буквально в самый уголок переднего бампера. Дальше «девятка», разрываясь на части, протесала кабину, платформу, топливный бак и оба левых колеса «шишиги», порвав переднюю шину и смяв оба диска. Несмотря на вроде бы не самую страшную картину разрушений грузовика, его после такого удара пришлось списывать, поскольку целыми у нее остались только двигатель да колеса по правой стороне. Раму загнуло буквой «Г», смялись балки обоих мостов и все карданы, «раздатку» оторвало от кузова. Благо, к тому времени основной объем от запланированной программы испытаний этот образец успел выполнить, и комиссия сочла возможным не строить дополнительный опытный образец ГАЗ-66-17. В результате модернизированная «шишига» получила «зеленый свет» и встала на конвейер Горьковского автозавода в конце 1991 года.

 

” />

Военная модификация с экранированным электрооборудованием, но без лебедки, получила индекс ГАЗ-66-18

 

Впрочем, эпопея с производством ГАЗ-66-16 оказалась недолгой. Фактически эти машины делали лишь до января 1993 года – то есть до момента вступления в силу новой системы сертификации автомобильного транспорта, требовавшей получения одобрения типа транспортного средства (ОТТС) на каждую модель автомобиля. После этой даты в сертификатах оставили только одну базовую модель – 66-11, которую к тому времени уже фактически превратили в подобие 66-16. По крайней мере, возможность комплектации радиальными шинами КИ-115 для ГАЗ-66-11 внесли в технические условия еще в августе 1990-го, а с июня 1992-го «одиннадцатые» начали производиться с той же самой новой грузовой платформой без надколесных ниш.

 

” />

 

В первом же ОТТС «шишиги», выданном в январе 1993 года, грузоподъемность ГАЗ-66-11 была повышена до 2180 кг (результат вычитания из полной массы значений снаряженной массы и веса водителя с пассажиром). А во втором одобрении, выданном в феврале 1994-го, уже появился и новый 125-сильный мотор ЗМЗ-513.10 – тот же самый, что стоял на ГАЗ-66-16. Впрочем, в этот же самый период времени на ГАЗе краткосрочно выпускали еще одну версию «шишиги» повышенной грузоподъемности, но о ней мы поговорим уже в другой раз.

 

” />

 

Текст: Николай Марков
Фото: архив автора и ОИЦ ГАЗ
Источник

Фургоны и контейнеры

Пришлось немного повозиться, чтобы исправить просчеты американских конструкторов. Борта будок обили войлоком и фанерой, пол застелили досками, но микроклимат в них почти не изменился и зимой ноги по-прежнему мерзли, несмотря на постоянно включенные электрокалориферы. Пришлось принять более радикальные меры, то есть заменить металлические будки деревянными, с утепленными бортами и полом, а вместо электрокалориферов установить небольшие железные печки-буржуйки»*.

Сегодня в армиях широко применяются кузова-фургоны различных типов. В их конструкции используются легкие сплавы и синтетические материалы. Они оборудуются совершенными отопительно-вентиляционными системами, кондиционерами. Для действий в условиях применения оружия массового поражения они герметизируются и оснащаются фильтровентиляционными установками. Кузова-фургоны могут устанавливаться не только на автомобилях, но и на прицепах.

Рис. 2. ГАЗ-66 с кузовом-фургоном К-66

В зависимости от конкретного оборудования, размещаемого в нем, стандартный армейский кузов-фургон может иметь различное число и расположение окон, дверей, люков для доступа к оборудованию.

С конца 60-х гг. в армиях стран НАТО применяют съемные кабины-контейнеры, которые перевозятся обычными многоцелевыми автомобилями. Они оборудуются как пункты управления, радиолокационные станции, узлы связи, полевые госпитали, мастерские и т. д. У них есть фильтровентиляционные установки, автономное освещение. Изготовляются кабины из алюминиевых сплавов.

Если нужно, контейнер легко можно перегрузить с одной машины на другую, например при поломке автомобиля. Делается это с помощью штатных войсковых автокранов или погрузчиков. Контейнер можно выгрузить на землю и использовать как стационарную кабину. Автомобиль в это время будет выполнять другую работу. Контейнеры приспособлены также для перевозки воздушным, водным и железнодорожным транспортом.

Рис. 3. ЗИЛ-131 с кузовом-фургоном К-131

Дисморфическое расстройство тела

Диалоги Clin Neurosci. 2010 июнь; 12(2): 221–232.

Язык: английский | испанский | French

, PhD *

Andri S. Bjornsson, Больница Род-Айленда и Медицинская школа Альперта Университета Брауна, Провиденс, Род-Айленд, США;

Andri S. Bjornsson

Больница Род-Айленда и Медицинская школа Альперта Университета Брауна, Провиденс, Род-Айленд, США США;

Элизабет Р.Didie

Больница Род-Айленда и Медицинская школа Альперта Университета Брауна, Провиденс, Род-Айленд, США

, MD

Кэтрин А. Филлипс, Больница Род-Айленда и Медицинская школа Альперта Университета Брауна, Провиденс, Род-Айленд, США;

Katharine A. Phillips

Больница Род-Айленда и Медицинская школа Альперта Университета Брауна, Провиденс, Род-Айленд, США

Эта статья находится в открытом доступе и распространяется в соответствии с условиями лицензии Creative Commons Attribution (http://creativecommons.org/licenses/by-nc-nd/3.0/), что разрешает неограниченное использование, распространение и воспроизведение на любом носителе при условии правильного цитирования оригинальной работы. Эта статья цитировалась в других статьях PMC.

Abstract

Дисморфическое расстройство тела (BDD) является относительно распространенным расстройством, которое состоит из мучительной или вредной озабоченности воображаемыми или незначительными дефектами внешности. BDD обычно считается расстройством обсессивно-компульсивного спектра на основании сходства, которое оно имеет с обсессивно-компульсивным расстройством.Важно распознавать и соответствующим образом лечить дисморфофобию, так как это расстройство связано с выраженными нарушениями психосоциального функционирования, особенно низким качеством жизни и высоким уровнем суицидальных наклонностей. В этом обзоре мы представляем обзор результатов исследований BDD, включая его эпидемиологию, клинические особенности, течение болезни, сопутствующие заболевания, психосоциальное функционирование и суицидальность. Мы также кратко рассматриваем недавние исследования нейронных субстратов и когнитивной обработки. Наконец, мы обсуждаем подходы к лечению, которые кажутся эффективными при дисморфофобии, с акцентом на ингибиторы обратного захвата серотонина и когнитивно-поведенческую терапию.

Ключевые слова: дисморфическое расстройство тела; , Dysmorphophophobia , Застройка заблуждения , Somatoform расстройство , Осессивно-компульсивный спектр , Клиническая особенность , Эпидемиология , Epidemiology , Обработка

Абстрактный

EL TRASTORNO SMOPORFICO CARRAL (TDC) ES UNA Patología relativamente común дие себе caracteriza пор уна preocupación agobiante о limitante relacionada кон дефектос leves о imaginarios де ла apariencia.Habitualmente себе рассмотреть эль TDC como ип trastorno дель espectro obsesivo-compulsivo, dadas las similitudes que tiene con el trastorno obsesivocompulsivo. Es Importante reconocer y tratar apropiadamente el TDC, ya que este trastorno se asocia con un marcado deterioro del funcionamiento psicosocial, una muy pobre calidad de vida y alta frecuencia de suicidalidad. En Esta Revisión se Entrega una Panorámica de los Hallazgos de la Investigacion en el TDC, incluyendo su epidemiología, las características clinicas, el curso de la enfermedad, la comorbilidad, el funcionamiento psicosocial y la suicidalidad. También себе revisa bremente la Investigacion reciente sobre los sustratos neuroles y el procesamiento cognitivo. Finalmente себе discuten лас aproximaciones terapéuticas дие parecen eficaces пункт эль TDC, кон ип фокус ан лос ингибиторов де ла recaptura де серотонина у ла terapia когнитивно-проводниковой.

Резюме

Проблема дисморфофобии является относительной проблемой, связанной с несовершенством или воображаемым видом.Дисморфофобия считается вызывающей беспокойство, связанной с призраком обсессионно-компульсивного состояния (TOC), и основывается на сходствах с TOC. Важнейшее значение для разведки и исправления предателей, эта проблема вызывает ассоциации с важным изменением психосоциальной функции, особенно в отношении качества жизни и предотвращения самоубийств. В этой статье представлены травмы, связанные с дисморфофобией, включая эпидемиологическую картину, клиническую картину, развитие болезни, сопутствующие заболевания, психосоциальные функции и причины самоубийства. Nous présentons également rapidement les résultats de recherche récente sur les субстраты neuaux et les processus cognitifs. Nous abordons finalement les traitements qui semblent efficaces pour этой патологии, en mettant l’accent sur les ингибиторы де ла recapture де ла серотонин et le когнитивно-comportemental.

Дисморфическое расстройство тела (BDD) — это расстройство DSM-IV , которое характеризуется тревожной или вредной озабоченностью незначительными или воображаемыми дефектами своей внешности.BDD постоянно описывалось во всем мире более века 1,2 Энрико Морселли, итальянский врач, назвавший это расстройство «дисморфофобией», в 1891 году дал такое острое описание: «Пациент с дисморфофобией действительно несчастен; среди своих повседневных дел, разговоров, во время чтения, во время еды, фактически везде и в любое время одолевает страх уродства… который может достигать очень болезненной интенсивности, вплоть до плача и отчаяние». 3 БДР позже было описано выдающимися психиатрами, такими как Эмиль Крепелин и Пьер Жане 4,5 , и за прошедшие годы было получено множество сообщений о клинических случаях со всего мира. 6

Несмотря на долгую историю, BDD систематически исследуется менее двух десятилетий. За это время многое стало известно об этом расстройстве, включая его клинические особенности, эпидемиологию и лечение. Хотя это все еще очень предварительные данные, начинают появляться данные о нейрокогнитивном дефиците BDD и лежащей в его основе нейробиологии.BDD становится все более известным, но остается малоизвестным. 7-11 Поскольку дисморфофобия вызывает значительные страдания и ухудшение функционирования, необходимо более широкое признание этого часто изнурительного состояния во всех специальностях. 12

Определение и классификация BDD

Здесь мы приводим определение DSM-IV для BDD и кратко комментируем каждый диагностический критерий.

А) «Озабоченность воображаемым дефектом внешности.Если присутствует небольшая физическая аномалия, беспокойство человека заметно чрезмерно». Наиболее распространенная озабоченность сосредоточена на коже (например, рубцы, прыщи, цвет), волосах (например, облысение, чрезмерное оволосение лица или тела) или носе (например, размер или форма), хотя в центре внимания может быть любая часть тела. беспокойства. 13 «Озабоченность» в критерии А не операционализирована, но часто определяется как размышление о воспринимаемом(ых) дефекте(ах) внешности не менее 1 часа в день (аналогично обсессивно-компульсивному расстройству [ОКР]). 1,14,15

B) «Озабоченность вызывает клинически значимый дистресс или нарушение в социальной, профессиональной или других важных сферах жизнедеятельности». Как и при других расстройствах, дистресс и нарушение функционирования различаются по степени тяжести. Но, как правило, пациенты испытывают значительные нарушения в социальной, профессиональной и академической деятельности, что будет обсуждаться далее в этом обзоре.

C) «Озабоченность не лучше объясняется другим психическим расстройством (например, неудовлетворенность формой и размерами тела при нервной анорексии).Этот критерий указывает на то, что если внешний вид человека беспокоит только из-за того, что он слишком много весит или слишком толст, и человек соответствует диагностическим критериям нервной анорексии или нервной булимии, то диагностируется расстройство пищевого поведения, а не расстройство пищевого поведения. Тем не менее, BDD и расстройства пищевого поведения часто являются коморбидными, и в этом случае следует диагностировать оба расстройства. 16,17

DSM впервые включил BDD в третье издание (DSM-III), , где оно было названо «дисморфофобия». 18 В DSM-III, это был пример атипичного соматоформного расстройства (обозначение «атипичное» было похоже на категорию «Не указано иное» в DSM-IV ), и диагностические критерии не были предоставлены. BDD впервые получили диагностические критерии и были классифицированы как отдельное расстройство (соматоформное расстройство) в DSM-III-R, , где оно было названо «дисморфическим расстройством тела». 19 В текущей редакции DSM (DSM-IV-TR) BDD также классифицируется как соматоформное расстройство. 15 МКБ-10 классифицирует дисморфофобию, наряду с ипохондрией, как тип «ипохондрического расстройства», также в соматоформном разделе. 20 В процессе разработки DSM-TV рассматривался вопрос о переносе BDD в раздел тревожных расстройств DSM , , но в то время не было достаточных данных, чтобы определить, оправдано ли это изменение. 21 На рассмотрении для DSM-5 рассматривается возможность включения BDD в раздел «Тревожные и обсессивно-компульсивные расстройства спектра», хотя пока неизвестно, будет ли такой раздел включен в DSM-5. 22 Клинически важным вопросом является то, как следует классифицировать бредовый вариант BDD (при котором пациенты полностью убеждены в том, что они кажутся уродливыми или ненормальными). В DSM-TV бредовый вариант BDD классифицируется как тип бредового расстройства соматического типа в разделе психозов руководства. 15 Однако DSM-TV позволяет дважды кодировать BDD и его вариант бредового расстройства; другими словами, пациентам с бредовым расстройством личности может быть поставлен диагноз как бредового расстройства, так и расстройства личности. 15 Это двойное кодирование свидетельствует о том, что бредовые и небредовые варианты BDD на самом деле могут быть вариантами одного и того же расстройства. 7,23,24 Важно отметить, что бредовый вариант BDD, по-видимому, отвечает на лечение монотерапией ингибитором обратного захвата серотонина (SRI), и, хотя данные очень предварительные, лечение нейролептиками не кажется многообещающим. 25,26 В процессе разработки DSM-5 рассматривается возможность объединения бредового варианта BDD с его небредовым вариантом в одно расстройство (BDD) с указанием степени понимания (с хорошим или удовлетворительным пониманием, с плохим пониманием, или с бредовыми убеждениями BDD). 17

Эпидемиология

БДД встречается относительно часто. Эпидемиологические исследования показали точечную распространенность от 0,7% до 2,4% в общей популяции. 27-30 Эти исследования показывают, что дисморфофобия встречается чаще, чем такие расстройства, как шизофрения или нервная анорексия. 15 Исследования неклинических выборок взрослых учащихся показали более высокие показатели распространенности от 2% до 13%. 31-35

БДР обычно встречается в клинических условиях, при этом в исследованиях сообщается о распространенности от 9% до 12% в дерматологических учреждениях, от 3% до 53% в условиях косметической хирургии, от 8% до 37% у лиц с ОКР, от 11% до 13% при социальной фобии, 26% при трихотилломании и от 14% до 42% при атипичном большом депрессивном расстройстве (БДР). 8,36-49 Исследования психиатрических стационарных пациентов показали, что от 13% до 16% пациентов имеют DSM-TV BDD. 9,50 Исследование подростков, находящихся в стационаре, показало, что у 4,8% пациентов была дисплазия. 10

Эти исследования показывают, что дисморфофобия встречается относительно часто. Однако эти оценки могут занижать его распространенность. Многие люди с дисморфофобией стыдятся своей внешности и того факта, что они так сосредоточены на ней. Как следствие, они могут не сообщать врачам о своих симптомах BDD.В одном исследовании психиатрических стационарных пациентов только 15,1% рассказали о своих проблемах с телом своим психиатрам, и наиболее распространенной причиной нераскрытия своих проблем было смущение (у 31,3%). 50 Кроме того, в пяти исследованиях, в которых взрослые систематически обследовались на дисморфофобию, ни у одного пациента, у которого исследователи обнаружили дисморфофобию, не было в медицинской карте диагноза дисморфофобии. 7-11 Количество пациентов с дисморфофобией было следующим: 30 из 30, 11 из 80, 16 из 122, 10 из 208 и 16 из 122.

Демографические характеристики

Сообщается, что дисморфофобия встречается у детей в возрасте от 5 лет и у взрослых в возрасте от 80 лет. ; n = 2048, и другое, проведенное в Германии; n = 2552) выявило точечную распространенность 2,5% женщин против 2,2% мужчин и 1,9% женщин и 1,4% мужчин соответственно. 28,30 Крупнейшие клинические выборки лиц, у которых выявлена ​​дисморфофобия, содержали равную долю женщин и мужчин (49% из 188 участников были женщинами) 52 или несколько большую долю женщин (68.5% от 200 участников). 53 Таким образом, дисморфофобия может несколько чаще встречаться у женщин, но явно поражает и многих мужчин.

Два упомянутых ранее популяционных исследования показали, что люди с дисморфофобией реже вступают в брак, чем лица без дисморфофобии, 28,30 и с большей вероятностью разводятся. Лица с BDD также значительно чаще оказываются безработными, чем население в целом. 28,30 В выборке из 200 человек с дисморфофобией 37,6% были в настоящее время безработными. 54

Описание случая

Г-жа A, 32-летняя незамужняя белая женщина, была направлена ​​дерматологом в специализированную клинику BDD. Она жила одна, не состояла в романтических отношениях и не имела детей. Несмотря на то, что она закончила колледж, она подрабатывала клерком в бутике одежды. Г-жа А. объяснила свои трудности с поиском работы на полный рабочий день помехами, которые она испытывала из-за навязчивых мыслей и компульсивного поведения, связанных с ее проблемами внешности.

Г-жа А. выглядела нормально, но была озабочена внешним видом своей кожи (незначительные пятна и «неровный» тон кожи) с 13 лет. Она сообщила, что думает о своей внешности не менее 7-8 часов в день, и ее другие люди заметили бы ее или осудили ее негативно, потому что ее кожа выглядела такой «уродливой». В течение 5-6 часов в день г-жа А. проверяла свою кожу в зеркалах и других отражающих поверхностях, выбирала свою кожу и сравнивала свою кожу с кожей других людей. Она тратила тысячи долларов в год на средства по уходу за кожей и часто покупала специальное освещение и зеркала, чтобы лучше рассмотреть свою кожу.

Из-за того, что она была так озабочена своей кожей и беспокоилась о ней, г-жа А. часто опаздывала на работу, и ее производительность страдала, что приводило к конфликтам с ее начальником. Она часто «застревала» в зеркале на работе, разглядывая свою кожу. Поскольку г-жа А. была очень смущена своим внешним видом и боялась, что другие люди осудят ее негативно (например, как «ненормально выглядящую» и «отвратительную»), г-жа А. избегала любых контактов с друзьями и видела свою семью только в особых случаях. Г-жа А сообщила, что чувствует тревогу и депрессию из-за своей кожи.Она также выражала пассивные суицидальные мысли, потому что считала свою кожу такой уродливой.

Г-жа А. обращалась к нескольким дерматологам за лечением, направленным на улучшение внешнего вида ее кожи. Ее навязчивое ковыряние кожи было направлено на то, чтобы улучшить видимые недостатки кожи путем «сглаживания» ее кожи и удаления крошечных пятен. Однако из-за того, что ее ковыряние кожи было трудно контролировать и оно происходило в течение нескольких часов в день, такое поведение вызывало раздражение кожи, легкое покраснение и рубцы. Г-жа А. прошла три дерматологических процедуры, но по-прежнему была «одержима» улучшением качества своей кожи.«Я просто хочу выглядеть нормально!» заявила она. Г-жа А сообщила, что дерматологические процедуры мало изменили ее восприятие внешнего вида кожи и заставили ее чувствовать себя еще более тревожной и озабоченной. Это был первый раз, когда г-жа А обратилась за психиатрической помощью из-за проблем с кожей. В прошлом она не хотела обсуждать свои проблемы с психиатром, опасаясь, что ее сочтут «поверхностной» или «тщеславной».

Озабоченность внешним видом

Наиболее частыми участками тела, вызывающими беспокойство, являются кожа (73%), волосы (56%) и нос (37%). 52,55 Тем не менее, любой участок тела может быть предметом беспокойства. В среднем в течение жизни люди с дисморфофобией озабочены 5–7 различными частями тела. 52,55 Некоторые люди озабочены своим внешним видом; это включает в себя форму мышечной дисморфии BDD, которая состоит из веры в то, что тело слишком маленькое и неадекватно мускулистое. 56-58

Приблизительно 40 % людей с дисморфофобией активно думают о нелюбимых частях тела от 3 до 8 часов в день, а 25 % сообщают, что думают о них более 8 часов в день 6 всегда трудно сопротивляться или контролировать, они навязчивы и связаны со значительной тревогой и дистрессом. 1

Понимание воспринимаемых дефектов внешности

Понимание воспринимаемых дефектов внешности варьируется. В одной выборке 35,6% участников были классифицированы по надежной и достоверной шкале оценки убеждений Брауна (BABS59) как бредовые, то есть полностью уверенные в том, что их представления о том, как они выглядят, были точными. 60 До начала эффективного лечения немногие пациенты обладают хорошей интуицией. Исследования неизменно показывают, что понимание хуже при расстройстве личности, чем при ОКР: от 27% до 60% пациентов с расстройством личности имеют бредовые убеждения по сравнению с только 2% пациентов с ОКР. 13,61

Около двух третей пациентов с дисморфофобией имеют прошлые или текущие идеи или бред отношения, полагая, что другие люди обращают на них особое негативное внимание или насмехаются или высмеивают их из-за того, как они выглядят. 23 Клинические наблюдения показывают, что такое референциальное мышление может привести к чувству отторжения и гневу (даже к насилию, например, к нападению на кого-то, кто, по их мнению, насмехается над ним). 1

Как отмечалось ранее, пациенты с бредовыми представлениями о дисморфофобии получают диагноз бредового расстройства DSM-TV-TR или DSM-TV-TR диагнозы как бредового расстройства, так и диссоциативного расстройства.Исследования, сравнивающие пациентов с бредовым и не бредовым расстройством личности, выявили больше сходства, чем различий между двумя группами, и что основное различие заключается в тяжести симптомов расстройства личности 23,25,60 Важно отметить, что бредовое расстройство личности, по-видимому, отвечает на монотерапию СИОЗС и может не реагировать на антипсихотические препараты. , предполагая (с точки зрения лечения), что бредовое расстройство личности не является типичным психотическим расстройством. 26 Таким образом, может быть более правильным рассматривать инсайт как существующий в континууме и считать, что BDD охватывает как бредовые, так и не бредовые убеждения о внешнем виде. 62

Кроме того, некоторые люди с дисморфофобией описывают флуктуации инсайтов, например, когда они полностью убеждены в том, что они уродливы, но не убеждены в других. 6 Как заметил один пациент: «Иногда я думаю, что моя кожа не так уж и плоха, но в другие дни я в этом уверен». 1 Наблюдения, подобные этим, еще раз подтверждают мнение о том, что бредовое расстройство личности и небредовое расстройство личности представляют собой одно и то же расстройство, характеризующееся диапазоном инсайтов, а не разные расстройства.

Навязчивые действия, безопасное поведение и избегание

Диагностические критерии DSM-IV-TR для BDD не содержат ссылок на компульсивное поведение и безопасное поведение, которые обычно связаны с BDD; в процессе разработки DSM-5 рассматривается возможность добавления этих симптомов к диагностическим критериям BDD. 17 Действительно, почти каждый человек с дисморфофобией проявляет определенные действия, такие как проверка зеркала и ковыряние кожи, как показано в приведенном выше случае, которые связаны с их заботой о внешнем виде. 52,52 Взаимосвязь между мыслями и поведением при дисморфофобии похожа на связь между навязчивыми идеями и компульсиями при обсессивно-компульсивном расстройстве. То есть компульсивное поведение возникает в ответ на навязчивые мысли о внешнем виде и предназначено для уменьшения беспокойства и других болезненных эмоций. 13

Как и при ОКР, поведение не доставляет удовольствия. 13

Эти компульсивные действия повторяются, отнимают много времени (около половины пациентов с дисморфофобией тратят на них 3 и более часов в день), их трудно контролировать и сопротивляться им. 63 Некоторые виды поведения, такие как маскировка нелюбимых частей тела (например, шляпой, косметикой, солнцезащитными очками), называются поведением безопасности, поскольку их функция заключается в уменьшении или предотвращении болезненных эмоций или предотвращении чего-то плохого, например, унижения. или смущен. 1 Большинство пациентов с дисморфофобией проявляют множественные компульсивные действия. 52,55 Одним из распространенных способов поведения является сравнение себя с другими людьми. Клинические данные свидетельствуют о том, что обычно это происходит совершенно автоматически и может вызывать тревогу и неспособность сосредоточиться. Около 90% пациентов с дисморфофобией многократно и чрезмерно проверяют себя в зеркалах или других отражающих поверхностях. 1 Обычно они делают это в надежде, что выглядят приемлемо, но часто, увидев свое отражение, им становится хуже. 64 Другими распространенными повторяющимися действиями являются чрезмерный уход за собой (например, многократное расчесывание волос или мытье кожи), загар (для улучшения цвета кожи или устранения недостатков кожи), поиск уверенности (спрашивание о приемлемости внешности), чрезмерные покупки красоты товары, многократное переодевание в поисках более подходящего наряда и чрезмерные физические нагрузки (например, поднятие тяжестей при мышечной дисморфии). 1,52,55,64-66 Многие пациенты с дисморфофобией (от 27% до 45%) ковыряют свою кожу в попытке улучшить видимые пятна или недостатки; однако такое поведение иногда вызывает видимые дефекты внешнего вида и даже может привести к серьезным повреждениям, таким как кожные инфекции и разрыв кровеносных сосудов. 67-69 Существует много других примеров компульсивного поведения, которые часто носят идиосинкразический характер, например, выпивание более 3 галлонов воды в день, чтобы лицо выглядело полнее. 1

Избегание — обычное поведение при расстройстве личности. 70,71 Пациенты часто избегают социальных ситуаций, так как боятся, что другие люди осудят их негативно из-за того, что они выглядят «некрасиво». Они могут не браться за работу, где, по их мнению, другие будут внимательно их рассматривать. Избегание может служить той же цели, что и компульсивное поведение, в краткосрочной перспективе, то есть для временного облегчения тревоги и дистресса, связанных с BDD. Однако клинический опыт показывает, что навязчивые действия и избегание редко уменьшают тревожность или снижают интенсивность мыслей, связанных с дисморфофобией; скорее, такое поведение может способствовать хронизации и тяжести BDD. 1,72

Течение болезни

БДР обычно начинается в подростковом возрасте, при этом в двух исследованиях сообщается, что средний возраст начала заболевания — 16 лет, а мода — 13 лет. хроническое течение, если его не лечить. 52,55 В единственном, насколько нам известно, проспективном исследовании течения BDD было обнаружено, что вероятность полной ремиссии BDD в течение 1 года наблюдения составила всего 0,09, что ниже, чем сообщалось для расстройства настроения, большинство тревожных расстройств и расстройства личности в других продольных исследованиях. 74 Более тяжелые симптомы расстройства личности при приеме, более длительная продолжительность расстройства личности и наличие одного или нескольких сопутствующих расстройств личности при приеме предсказывали более низкую вероятность ремиссии расстройства личности. 75

Психосоциальное функционирование и качество жизни

Расстройство личности связано со значительным ухудшением психосоциального функционирования и заметно низким качеством жизни. В выборке из 200 человек с дисморфофобией (n=200) 36% не работали как минимум одну неделю за последний месяц из-за психопатологии, а 11% навсегда бросили школу из-за симптомов дисморфофобии. 54 Лица с дисморфофобией в среднем имеют гораздо худшее психическое здоровье, эмоциональное благополучие, социальное функционирование и общее качество жизни, чем население в целом, а показатели качества жизни ниже, чем у пациентов с диабетом или клиническими депрессия. 76,77 В единственном проспективном исследовании BDD общее функционирование оставалось плохим в течение 1–3 лет, а ухудшение функционирования предсказывалось более тяжелым BDD и бредовыми представлениями о BDD при приеме внутрь. 78 Многие пациенты с более тяжелым дисморфофобическим расстройством не могут работать, ходить в школу или посещать ее, а также иметь отношения. 1,54 В двух исследованиях от 27% до 31% лиц с дисморфофобией были полностью прикованы к дому в течение как минимум 1 недели из-за симптомов дисморфофобии, и более 40% были госпитализированы в психиатрическую больницу. 52,55

Рискованное поведение: суицидальные наклонности, злоупотребление психоактивными веществами и насилие

Частота суицидальных мыслей, суицидальных попыток и завершенных суицидов заметно повышена. 79 Приблизительно 80% людей с дисморфофобией сообщают о прошлых или текущих суицидальных мыслях, и около четверти совершали суицидальные попытки, что часто связывают с симптомами дисморфофобии. 42,50,52,79-81 В единственном проспективном исследовании течения БДР завершенный суицид регистрировался в 0,3% случаев в год. 82 Этот вывод следует считать предварительным, поскольку размер выборки был относительно небольшим, а период наблюдения был относительно коротким; тем не менее, этот уровень самоубийств заметно повышен.Хотя следует с осторожностью сравнивать этот показатель с показателями других расстройств, стандартизированный коэффициент смертности в этом исследовании выше, чем тот, о котором сообщается почти для любого другого психического расстройства. 83

Приблизительно одна треть людей с дисморфофобией сообщают о агрессивном поведении, которое они связывают главным образом с симптомами дисморфофобии (например, нападение на кого-либо или повреждение имущества). 1,84 Клинические впечатления предполагают, что гнев или насилие могут подпитываться гневом из-за того, что вы выглядите «деформированным», неспособности исправить «дефект», бреда соотнесения (например, убеждения, что другие люди насмехаются над «дефектом») и чувство отверженности другими из-за «недостатка».Кроме того, гнев или даже агрессивное поведение может быть вызвано неудовлетворенностью косметическими процедурами. Согласно одному опросу, 12% пластических хирургов заявили, что им угрожали физически недовольные пациенты с дисморфофобией. 85 Время от времени поступают сообщения о людях с вероятным расстройством личности, которые напали и даже убили своего пластического хирурга после того, как были обезумели от результата косметической процедуры. 2

Многие люди с дисморфофобией злоупотребляют алкоголем или наркотиками. В одном исследовании 86 48.У 9% участников BDD было диагностировано пожизненное расстройство, связанное с употреблением психоактивных веществ, при этом 42,6% сообщили о расстройстве, связанном с употреблением алкоголя, и 30,1% сообщили о расстройстве, связанном с употреблением каннабиса. Начало BDD предшествовало возникновению расстройства, связанного с употреблением психоактивных веществ, по крайней мере, за 1 год у 60% участников, последовало за началом расстройства, связанного с употреблением психоактивных веществ, у 19% участников и началось в том же году у 21%. Отвечая на вопрос о связи между употреблением психоактивных веществ и симптомами расстройства личности, 68% ответили, что симптомы расстройства психики способствовали тому, что употребление психоактивных веществ стало проблематичным. 86

Сопутствующая патология

ДПР часто сочетается с другими психическими расстройствами. В двух крупнейших феноменологических исследованиях лиц с диагнозом BDD (n = 293 и n = 200), в которых всех участников оценивали с помощью структурированного клинического интервью для DSM, 14 большое депрессивное расстройство было наиболее частым сопутствующим расстройством с распространенность в течение жизни около 75% в обеих выборках. 55,73 Другими наиболее распространенными сопутствующими расстройствами в течение жизни были расстройства, связанные с употреблением психоактивных веществ (от 30% до 48. 9%), ОКР (от 32% до 33%) и социофобии (от 37% до 39%). 55,73,86

Расстройство личности у детей и подростков

Несмотря на то, что расстройство расстройств обычно начинается в возрасте до 18 лет, очень мало исследований систематически изучали широкий спектр клинических проявлений расстройства речи у молодежи. 87,88 Как и взрослые, молодые люди сообщают о ярко выраженной, тревожной и отнимающей много времени озабоченности внешним видом, а также о выраженном навязчивом поведении, связанном с внешним видом. Почти все молодые люди испытывают нарушения психосоциального функционирования, которые в первую очередь связаны с симптомами расстройства личности.В исследовании 33 детей и подростков 87 18% бросили начальную или среднюю школу в основном из-за симптомов дисморфофобии, а в исследовании 36 молодых людей 22% бросили школу в основном из-за дисморфофобии. 88 Такие трудности могут быть особенно проблематичными в подростковом возрасте, поскольку они могут существенно мешать важным переходным периодам в развитии подростка. 1,87,89

Предварительные данные свидетельствуют о том, что дисморфофобия у подростков и взрослых во многом сходна; однако в исследовании, в котором подростков напрямую сравнивали со взрослыми, у подростков было больше бредовых представлений о своей внешности, и они значительно чаще страдали в настоящее время расстройством, связанным с употреблением психоактивных веществ (30.6% против 12,8%) и суицидальные попытки в анамнезе (44,4% против 23,8%). 88 В стационарном исследовании подростков подростки с дисморфофобией (n=14) имели значительно более высокие баллы, чем подростки без клинически значимых проблем с образом тела (n=140) по Шкале вероятности самоубийства, которая отражает риск самоубийства. 10,90

Нервные субстраты и когнитивная обработка

Результаты нейропсихологических исследований показывают, что люди с дисморфофобией уделяют больше внимания деталям визуальных стимулов, чем глобальным аспектам. 91 Аналогичным образом, исследование лицевой обработки с помощью фМРТ выявило предвзятость среди субъектов с расстройствами личности в отношении использования стратегий для кодирования деталей стимулов, а не использования целостных стратегий обработки изображений. 92 Эти результаты согласуются с клиническими наблюдениями о том, что люди с дисморфофобией чрезмерно сосредотачиваются на незначительных деталях своей внешности, что, как предполагается, подпитывает озабоченность незначительными или несуществующими недостатками внешности. 1,72,92,93 Недавние исследования показывают, что при дисморфофобии присутствуют и другие нарушения обработки информации, например, угрожающая интерпретация неопасных сценариев и переоценка привлекательности лиц других людей. 94 В исследованиях, в которых использовались фотографии, демонстрирующие эмоциональные выражения, 94,95 субъекты с расстройствами личности по сравнению со здоровыми людьми из контрольной группы были склонны ошибочно интерпретировать нейтральные эмоциональные выражения как презрительные и гневные в сценариях, которые были самореферентными (т. е. когда кто-то, как говорили, смотрел на на тему BDD). 94 Этот вывод согласуется с тем, как люди с дисморфофобией часто сообщают об идеях или бреде отношений (мысли о том, что их оценивают негативно или отвергают из-за их внешности). Дальнейшие исследования необходимы для дальнейшего изучения этой важной области и оценки последствий для лечения.

Были проведены дополнительные нейровизуализационные исследования с некоторыми сходными и некоторыми отличающимися результатами в разных исследованиях; результаты следует считать предварительными, поскольку размеры выборки были небольшими и было опубликовано мало исследований. Небольшое исследование с помощью МРТ показало, что у субъектов с BDD по сравнению со здоровыми участниками контрольной группы наблюдалась значительно аномальная асимметрия хвостатого ядра со сдвигом влево коэффициента латеральности, а также больший общий объем белого вещества. 96 Второе небольшое исследование аналогичным образом обнаружило больший объем белого вещества при BDD по сравнению с контрольной группой, в дополнение к меньшим размерам орбитофронтальной коры и передней поясной извилины и большим объемам таламуса. 97 Тем не менее, третье исследование не выявило существенных объемных различий у BDD по сравнению со здоровым контролем. 98 Небольшое исследование однократной протонно-эмиссионной компьютерной томографии BDD показало относительный дефицит перфузии в передневисочной и затылочной областях с обеих сторон и асимметричную перфузию в теменных долях. 99 В другом исследовании при просмотре фотографии своего лица в сравнении со знакомым лицом у испытуемых с BDD наблюдалась относительная гиперактивность левой орбитофронтальной коры и двусторонней головки хвостатого хвоста по сравнению с контрольной группой; лобно-стриарная активация коррелирует с рейтингом отвращения к лицам и тяжестью BDD. 100 Эти результаты аналогичны результатам исследований провокации симптомов ОКР, 101 предполагая, что симптомы РДР и ОКР могут быть опосредованы одним и тем же орбитофронтально-подкорковым контуром (хотя в этом исследовании прямое сравнение РДР и ОКР не проводилось).

Косметическое лечение BDD

Большинство людей с BDD обращаются (от 71% до 76%) и получают (от 64% до 66%) косметическое лечение (например, хирургическое, дерматологическое или стоматологическое) из-за предполагаемых недостатков внешности. 102,103 В общей популяционной выборке из Германии 7,2% пациентов с дисморфофобией подвергались косметической хирургии, по сравнению с только 2,8% лиц без дисморфофобии. 30 Однако такое лечение лишь в редких случаях улучшает общие симптомы дисморфофобии. В исследовании 200 человек с дисморфофобией испытуемые ретроспективно сообщили, что только 3.6% всех процедур привели к общему улучшению BDD. 102 В другом исследовании (n=250) только 7% лечения (по ретроспективной оценке) приводили к общему улучшению BDD. 103 Veale и соавторы обнаружили, что 81% из 50 пациентов с дисморфофобией были недовольны прошлыми медицинскими консультациями или операциями. 81 Такой исход может иметь серьезные негативные последствия как для пациентов, так и для врачей. В ранее упомянутом опросе косметических хирургов 40% респондентов указали, что неудовлетворенные пациенты с расстройствами психики угрожали им физически или юридически 85 Поэтому важно, чтобы пациенты с расстройствами психики и их поставщики психиатрических услуг знали, что вмешательство, не связанное с психическим здоровьем, маловероятно. для успешного лечения симптомов BDD.

Фармакотерапия

Фармакологическое лечение дисморфофобии более подробно описано в других источниках, 1,26 , в том числе в Кокрановском обзоре и руководстве Национального института клинического мастерства Соединенного Королевства (NICE) по лечению обсессивно-компульсивного расстройства и дисморфофобии, которое рекомендовать СИОЗС для лечения BDD. 104,105 Управление по санитарному надзору за качеством пищевых продуктов и медикаментов США (FDA) не одобрило ни одного лекарства для лечения дисморфофобии; исследования, необходимые для одобрения FDA, не проводились в BDD. В настоящее время СИОЗС рекомендуются в качестве препаратов первой линии при дисморфофобии, включая бредовые дисморфофобии. 1,26,104,105 В двух контролируемых исследованиях, четырех открытых исследованиях и клинических сериях сообщалось об эффективности ИОЗС при дисморфофобии. Все исследования показали, что эти лекарства часто эффективны при дисморфофобии. 106-110 В рандомизированном двойном слепом исследовании с параллельными группами флуоксетин оказался более эффективным, чем плацебо (d=0,70). 111 В рандомизированном двойном слепом перекрестном исследовании кломипрамин из группы SRI оказался более эффективным, чем антидепрессант дезипрамин, не относящийся к группе SRI. 106 Четыре открытых исследования (флувоксамина, циталопрама и эсциталопрама), ретроспективные исследования широкого спектра СИОЗС и серии случаев также свидетельствуют о том, что СИОЗС часто эффективны при дисморфофобии и связанных с ней симптомах. 7,107-109,112-115

Антидепрессанты SRI кажутся более эффективными при BDD, чем антидепрессанты не-SRI или другие типы психотропных препаратов, хотя данные ограничены. 26 Часто требуются относительно высокие дозы СИОЗС, и текущие рекомендации заключаются в том, что СИОЗС следует принимать в течение как минимум 12 недель, прежде чем определить, эффективен ли он. 1,26 В то же время, если это не помогает, следует дополнить ИОЗС другим лекарством или заменить ИОЗС на другой ИОЗС. 1,115 Успешная терапия SRI приводит к менее частым и интенсивным озабоченностям внешним видом, уменьшению дистресса, связанного с BDD, менее интенсивным побуждениям и меньшему времени, затрачиваемому на компульсивное/безопасное поведение, а также к лучшему контролю над озабоченностью и компульсиями BDD. 26 Большинство исследований показали, что сопутствующие симптомы, такие как симптомы депрессии, функционирование и качество жизни также часто улучшаются. 26,116 Кроме того, большинство исследований показали, что понимание воспринимаемых недостатков внешности улучшается при лечении SRI. 26

Доступно мало данных об эффективности антипсихотических препаратов при дисморфофобии, даже несмотря на то, что многие пациенты имеют бредовые представления о дисморфофобии. Несколько сообщений о случаях указывают на успешную аугментацию СИОЗС антипсихотиками. 117,118 Однако исследование, в котором изучалась эффективность аугментации флуоксетина пимозидом по сравнению с плацебо, показало, что аугментация пимозидом не более эффективна, чем аугментация плацебо. 119 Размер выборки был небольшим (n=28), что повышало вероятность ошибки типа II.Однако размер эффекта был небольшим (d = 0,23), и только 18,2% пациентов ответили на пимозид (по сравнению с 17,6% на плацебо), что предполагает минимальную эффективность пимозидной аугментации. В небольшой серии случаев оланзапина в сочетании с флуоксетином симптомы дисморфофобии были минимально улучшены у 2 из 6 пациентов, и ни у одного пациента не наблюдалось более существенного улучшения, что позволяет предположить, что атипичные нейролептики могут быть неэффективны при дисморфофобии. 120 Были предварительно изучены другие стратегии аугментации, и данные свидетельствуют о том, что буспирон, а иногда и другие лекарства, могут быть полезны при добавлении к СИОЗС. 1,26,114,115

Два открытых исследования (n=17 для обоих исследований) позволяют предположить, что ингибитор обратного захвата серотонина и норадреналина венлафаксин или противоэпилептический препарат леветирацетам могут быть эффективны для некоторых пациентов с дисморфофобией. 121,122 Хотя эти результаты являются многообещающими, небольшие размеры выборки, отсутствие контрольной группы и отсутствие репликации указывают на то, что в настоящее время эти препараты не следует рассматривать как препараты первой линии для лечения дисморфофобии.

Когнитивно-поведенческая терапия

Имеющиеся исследования показывают, что когнитивно-поведенческая терапия (КПТ) может быть эффективной при дисморфофобии. 123,125 В большинстве исследований изучалась комбинация когнитивных компонентов (например, когнитивная реструктуризация, направленная на изменение предположений и убеждений, связанных с внешним видом) с поведенческими компонентами, состоящими в основном из воздействия и предотвращения реакции (ERP) для уменьшения избегающего и компульсивного поведения и поведения, связанного с безопасностью. . Результаты нейропсихологических исследований (как рассмотрено выше) поддерживают использование когнитивно-поведенческих стратегий, помогающих пациентам меньше сосредотачиваться на незначительных деталях своей внешности и вместо этого рассматривать свое тело более «целостно». 126

Ранние отчеты о случаях указывали на то, что экспозиционная терапия может быть эффективной. 127,128 В последующей серии, в которой пациенты с дисморфофобией (n=17) получали 20 сеансов ежедневной индивидуальной 90-минутной когнитивно-поведенческой терапии, тяжесть симптомов дисморфофобии значительно уменьшилась. 129 В открытом исследовании групповой когнитивно-поведенческой терапии (n=13), проводившейся в течение двенадцати 90-минутных сеансов, значительно улучшились симптомы дисморфофобии и депрессии (от тяжелых до умеренных). 124 В исследовании с участием десяти участников, получивших тридцать 90-минутных индивидуальных сеансов ERP без когнитивного компонента и 6 месяцев профилактики рецидивов, улучшение сохранялось до 2 лет. 130

Опубликовано два контролируемых исследования списка ожидания. Veale, Gournay и коллеги рандомизировали 19 пациентов для 12 еженедельных сеансов индивидуальной когнитивно-поведенческой терапии или 12-недельного контрольного листа ожидания без лечения. 123 Два измерения симптомов BDD показали значительное улучшение при КПТ по сравнению с состоянием из списка ожидания. В рандомизированном контролируемом исследовании групповой КПТ при дисморфофобии 54 женщины были распределены в группу лечения КПТ (в рамках 8 еженедельных 2-часовых сеансов) или в контрольную группу ожидания без лечения. 131 Субъекты, получавшие когнитивно-поведенческую терапию, имели значительно более выраженное улучшение симптомов дисморфофобии, самооценки и депрессии, чем пациенты из списка ожидания с большим эффектом. Несмотря на то, что эти результаты являются предварительными, они предполагают, что КПТ очень многообещающа для лечения дисморфофобии.

Одной из проблем при лечении пациентов с когнитивно-поведенческой терапией является то, что многие из них недостаточно мотивированы для лечения из-за плохой интуиции (т. е. не признают, что у них есть излечимое психическое заболевание, или считают, что им нужно косметическое лечение, а не лечение психического здоровья). Клинические впечатления показывают, что использование методов мотивационного интервьюирования может быть полезным. 125,132 Кроме того, при некоторых симптомах дисморфофобии могут потребоваться специальные методы, такие как использование тренинга по изменению привычки для компульсивного щипания кожи или выщипывания волос. 126

В настоящее время неизвестно, являются ли лекарства или когнитивно-поведенческая терапия более эффективными при дисморфофобии, так как рандомизированные контролируемые исследования не сравнивали их напрямую. Кроме того, неизвестно, является ли комбинация лекарств и когнитивно-поведенческой терапии более эффективной, чем лечение по отдельности.Однако, основываясь на клиническом опыте, авторы рекомендуют, чтобы все пациенты с тяжелой дисморфофобией, тяжелыми депрессивными симптомами или активными суицидальными мыслями получали СИОЗС, а в идеале оба вида лечения. 1 Для оценки этих важных вопросов необходимы дальнейшие исследования.

Альтернативные психосоциальные методы лечения

Несмотря на тяжелую заболеваемость, связанную с дисморфофобией, существует мало эффективных методов лечения и насущная потребность в дополнительных вариантах лечения и дополнительных исследованиях в области лечения. В настоящее время КПТ является единственным психосоциальным методом лечения с предварительной эмпирической поддержкой.Однако некоторые пациенты отказываются от КПТ или преждевременно прекращают терапию 133 Поэтому необходимы альтернативные методы лечения. Межличностная психотерапия (ИПТ) может предложить многообещающую альтернативу. Люди с BDD часто имеют историю эмоционального насилия, 134 давних межличностных конфликтов, 135 и могут страдать от социальной тревожности и межличностных проблем. 70,71 ИПТ позволяет пациентам разработать более эффективные стратегии для уменьшения межличностного дистресса, низкой самооценки и депрессивного настроения, 136,137 , которые, как предполагается, поддерживают проблемы с образом тела. Результаты небольшого пилотного открытого испытания (n=9) в отношении предварительной эффективности ИПТ при дисморфофобии являются многообещающими, 138 , и в настоящее время проводится рандомизированное контролируемое исследование.

Выводы

Несмотря на распространенность и тяжесть дисморфофобии, это расстройство остается недостаточно диагностированным в клинических условиях. Учитывая заметно плохое функционирование и качество жизни, а также высокий уровень суицидальных наклонностей среди этих пациентов, важно распознать и точно диагностировать дисморфофобию. 12 125

Интервенционные исследования BDD все еще ограничены; тем не менее, имеющиеся данные о лечении являются многообещающими и указывают на то, что у большинства пациентов наблюдается улучшение при соответствующем лечении, направленном конкретно на симптомы дисморфофобии.Имеются ограниченные данные о BDD у детей и подростков или выраженности BDD в других культурах. Появляются доказательства того, что дефицит обработки информации играет важную роль в BDD, но очень мало известно об этой важной теме. Есть надежда, что дальнейшие исследования BDD прояснят многие аспекты этого расстройства, которые остаются плохо изученными, приведут к более эффективному лечению и большему количеству вариантов лечения и, в конечном итоге, позволят предотвратить это тяжелое психическое расстройство.

Благодарности

Авторы благодарят Сару Хоус, Массачусетс, за ее помощь в подготовке рукописи.

ССЫЛКИ

1. Филипс К.А. Понимание дисморфического расстройства тела: основное руководство. Нью-Йорк, штат Нью-Йорк: Издательство Оксфордского университета. 2009 [Google Scholar]2. Филлипс К.А. Дисморфическое расстройство тела: дистресс воображаемого уродства. Am J Психиатрия . 1991; 148:1138–1149. [PubMed] [Google Scholar]3. Морселли Э. Сулла дисморфофобия и сулла тафефобия. Bolletinno della R Accademia di Genova .1891; 6: 110–119. [Google Академия]4. Крепелин Э. Психиатрия. Оксфорд, Великобритания: JA Barth . 1896 г. [Google Scholar]5. Джанет П. Навязчивые идеи и психастения. Париж, Франция: Феликс Алькан . 1903 г. [Google Scholar]6. Филлипс К.А. Разбитое зеркало: понимание и лечение телесной дисморфии Расстройство (2-е изд., исправленное) . Нью-Йорк, штат Нью-Йорк: Издательство Оксфордского университета . 2005 [Google Scholar]7. Филлипс К.А., МакЭлрой С.Л., Кек П.Е., младший, Поуп Х.Г., младший, Хадсон Дж.И. Дисморфическое расстройство тела: 30 случаев воображаемого уродства. Am J Психиатрия . 1993; 150:302–308. [PubMed] [Google Scholar]8. Филлипс К.А., Ниренберг А.А., Брендель Г., Фава М. Распространенность и клинические особенности дисморфического расстройства тела при атипичной большой депрессии. J Нерв Мент Дис . 1996; 184: 125–129. [PubMed] [Google Scholar]9. Грант Дж. Э., Ким С. В., Кроу С. Дж. Распространенность и клинические особенности дисморфофобии тела у подростков и взрослых психиатрических стационаров. Дж. Клин Психиатрия . 2001; 62: 517–522. [PubMed] [Google Scholar] 10.Дил Дж., Киттлер Дж., Филлипс К.А., Хант Дж. И. Дисморфическое расстройство тела и другие клинически значимые проблемы с образом тела у подростков, находящихся в психиатрических стационарах: распространенность и клинические характеристики. Детская психиатрия Хум Дев . 2006; 36: 369–382. [Бесплатная статья PMC] [PubMed] [Google Scholar]11. Циммерман М., Маттиа Д.И. Дисморфическое расстройство тела у психиатрических амбулаторных больных: распознавание, распространенность, коморбидность, демографические и клинические корреляты. Компр Психиатрия . 1998; 39: 265–270.[PubMed] [Google Scholar] 12. Томпсон С.М., Дуррани А.Дж. Растущая потребность в раннем выявлении дисморфических расстройств тела по всем специальностям. JR Soc Med . 2007; 100:61–62. [Бесплатная статья PMC] [PubMed] [Google Scholar]13. Филлипс К.А., Кэй У.Х. Связь телесного дисморфического расстройства и расстройств пищевого поведения с обсессивно-компульсивным расстройством. ЦНС Спектр . 2007; 12: 347–358. [PubMed] [Google Scholar] 14. Первый MB, Spitzer RL, Gibbon M, Williams JBW. Структурированное клиническое интервью для расстройств оси I DSM-IV-TR, исследовательская версия, версия для пациентов с психотическим скринингом (SCID-I/P W/PSY SCREEN) Нью-Йорк, штат Нью-Йорк: Биометрические исследования NYSPI .2002 [Google Scholar] 15. Американская психиатрическая ассоциация. Диагностическое и статистическое руководство по психическим расстройствам . 4-е изд., Текстовая редакция. Вашингтон, округ Колумбия: Американская психиатрическая ассоциация, 2000 г. [Google Scholar]16. Руффуло Дж. С., Филлипс К. А., Менар В., Фэй С., Вайсберг Р. Коморбидность дисморфического расстройства тела и расстройств пищевого поведения: тяжесть психопатологии и нарушение образа тела. Int J Eat Disord . 2006; 39:11–19. [PubMed] [Google Scholar] 18. Американская психиатрическая ассоциация. Диагностическое и статистическое руководство по психическим расстройствам . 1980 г. 3-е изд. Вашингтон, округ Колумбия: Американская психиатрическая ассоциация. [Google Академия] 19. Американская психиатрическая ассоциация. Диагностическое и статистическое руководство по психическим расстройствам . 3-е изд., перераб. Вашингтон, округ Колумбия: Американская психиатрическая ассоциация, 1987 г. [Google Scholar]20. Всемирная организация здравоохранения. Классификация психических и поведенческих расстройств МКБ-10. Клинические описания и рекомендации по диагностике . 1992 Женева, Швейцария: Всемирная организация здравоохранения.[Google Академия] 21. Филлипс К.А., Холландер Э. Дисморфическое расстройство тела В: Видигер Т.А., Фрэнсис А.Дж., Пинкус Х.А., Росс Р., Первый М.Б., Дэвис В.В., ред. Справочник по DSM-IV . Вашингтон, округ Колумбия: Американская психиатрическая ассоциация, 1996 г. [Google Scholar]22. Филлипс К.А., Стейн Д.Дж., Раух С.Л. и др. Следует ли включать группу расстройств обсессивно-компульсивного спектра в DSM-V? Подавить тревогу . В прессе [бесплатная статья PMC] [PubMed] [Google Scholar]23. Филлипс К.А., МакЭлрой С.Л., Кек П.Е., Поуп Х.Г., Хадсон Дж.И.Сравнение бредового и небредового дисморфического расстройства тела в 100 случаях. Психофармаколь Бык . 1994; 30: 179–186. [PubMed] [Google Scholar] 24. МакЭлрой С.Л., Филлипс К.А., Кек П.Е., Хадсон Дж.И. Дисморфическое расстройство тела: есть ли у него психотический подтип? Дж. Клин Психиатрия . 1993; 54: 389–395. [PubMed] [Google Scholar] 25. Mancuso S, Knoesen N, Castle DJ. Бредовое и небредовое дисморфическое расстройство тела. Компр Психиатрия . 2010;51:177–182. [PubMed] [Google Scholar] 26.Филлипс К.А., Холландер Э. Лечение дисморфического расстройства тела с помощью лекарств: доказательства, заблуждения и предлагаемый подход. Изображение тела . 2008; 5:13–27. [Бесплатная статья PMC] [PubMed] [Google Scholar]27. Faravelli C, Salvatori S, Galassi F, Aiazzi L, Drei C, Cabras P. Эпидемиология соматоформных расстройств: обзор сообщества во Флоренции. Soc Psychiatry Psychiatr Epidemiol . 1997; 32:24–29. [PubMed] [Google Scholar] 28. Коран Л.М., Абуджауд Э., Лардж М.Д., Серпе Р.Т. Распространенность дисморфофобии среди взрослого населения США. ЦНС Спектр . 2008; 13: 316–322. [PubMed] [Google Scholar] 29. Отто М.В., Вильгельм С., Коэн Л.С., Харлоу Б.Л. Распространенность телесного дисморфического расстройства в выборке женщин из сообщества. Am J Психиатрия . 2001;158:2061–2063. [PubMed] [Google Scholar] 30. Риф В., Бульманн У., Вильгельм С., Боркенхаген А., Бралер Э. Распространенность телесных дисморфических расстройств: опрос населения. Психол Мед . 2006; 36: 877–885. [PubMed] [Google Scholar] 31. Биби ЭЛ. Связь между телесным дисморфическим расстройством и депрессией, самооценкой, соматизацией и обсессивно-компульсивным расстройством. J Clin Psychol . 1998; 54: 489–499. [PubMed] [Google Scholar] 32. Боне А., Вильгельм С., Кютен Н.Дж., Флорин И., Баер Л., Дженике М.А. Распространенность телесного дисморфического расстройства в выборке немецкого студента колледжа. Психиатрия рез. . 2002; 109: 101–104. [PubMed] [Google Scholar] 33. Джансевер А., Узун О., Донмез Э., Озсахин А. Распространенность и клинические особенности дисморфического расстройства тела у студентов колледжей: исследование на турецкой выборке. Компр Психиатрия . 2003; 44: 60–64. [PubMed] [Google Scholar] 34.Mayville S, Katz RC, Gipson MT, Cabrai K. Оценка распространенности телесного дисморфического расстройства в этнически разнообразной группе подростков. Детский семейный конный завод J . 1999; 8: 357–362. [Google Академия] 35. Таки А.М., Шейх М., Говани С.А. и др. Дисморфическое расстройство тела: гендерные различия и распространенность среди пакистанских студентов-медиков. BCM Психиатрия . 2008; 8:20. [Бесплатная статья PMC] [PubMed] [Google Scholar]36. Холландер Э., Коэн Л.Дж., Симеон Д. Дисморфическое расстройство тела. Психиатр Энн .1993; 23: 359–364. [Google Академия] 37. Aouizerate B, Pujol H, Grabot D и др. Дисморфическое расстройство тела в выборке претендентов на косметическую хирургию. Европейская психиатрия . 2003; 18: 365–368. [PubMed] [Google Scholar] 38. Брауман-Минцер О., Лидьярд Р.Б., Филлипс К.А. и соавт. Дисморфическое расстройство тела у пациентов с тревожными расстройствами и большой депрессией: исследование коморбидности. Am J Психиатрия . 1995; 152:1665–1667. [PubMed] [Google Scholar] 39. Castle DJ, Molton M, Hoffman K, Preston NJ, Phillips KA.Корреляты беспокойства о дисморфии у людей, стремящихся к косметическим улучшениям. Aust NZ J Психиатрия . 2004; 38: 439–444. [Бесплатная статья PMC] [PubMed] [Google Scholar]40. Ishigooka J, Iwao M, Suzuki M, Fukuyama Y, Murasaki M, Miura S. Демографические особенности пациентов, обращающихся за косметической хирургией. Психиатрия Clin Neurosci . 1998; 52: 283–287. [PubMed] [Google Scholar]41. Келли К.Е., Альперт Дж.Е., Уортингтон Дж.Дж. и др. Дисморфическое расстройство тела у амбулаторных пациентов с большой депрессией. J Аффективное расстройство .2002; 69: 141–148. [PubMed] [Google Scholar]42. Перуджи Г., Джаннотти Д., Фраре Ф. и др. Распространенность, феноменология и коморбидность дисморфофобии тела (дисморфофобии) в клинической популяции. Int J Psych Clin Pract . 1997; 1: 77–82. [PubMed] [Google Scholar]43. Филлипс К.А., Дюфрен Р.Г., мл., Уилкель К.С., Витторио К.С. Частота дисморфических расстройств тела у дерматологических больных. J Am Acad Дерматол . 2000;42:436–441. [PubMed] [Google Scholar]44. Сарвер Д.Б., Вадден Т.А., Перчук М.Дж., Уитакер Л.А.Неудовлетворенность образом тела и дисморфическое расстройство тела у 100 пациентов косметической хирургии. Пласт Реконстр Сург . 1998; 101:1644–1649. [PubMed] [Google Scholar]45. Сориано Дж.Л., О’Салливан Р.Л., Баер Л., Филлипс К.А., МакНалли Р.Дж., Дженике М.А. Трихотилломания и самооценка: опрос 62 женщин, которые дергают за волосы. Дж. Клин Психиатрия . 1996; 57: 77–82. [PubMed] [Google Scholar]46. Узун О., Басоглу С., Акар А. и др. Дисморфическое расстройство тела у больных акне. Компр Психиатрия .2003; 44: 415–419. [PubMed] [Google Scholar]47. Варгель С., Улусахин А. Психопатология и образ тела у пациентов косметической хирургии. Эстетик Пласт Сург . 2001; 25: 474–478. [PubMed] [Google Scholar]48. Виндигни В., Паван С., Семензин М. и др. Важность распознавания дисморфофобии тела у пациентов косметической хирургии: нужна ли нашим пациентам предоперационная психиатрическая оценка? Евро J Plast Surg . 2002; 25: 305–308. [Google Академия] 49. Вильгельм С., Отто М.В., Цукер Б.Г., Поллак М.Х.Распространенность дисморфофобии тела у пациентов с тревожными расстройствами. J Тревожное расстройство . 1997; 11: 499–502. [PubMed] [Google Scholar]50. Конрой М., Менар В., Флеминг-Айвс К., Модха П., Церулло Х., Филлипс К.А. Распространенность и клинические характеристики дисморфофобии тела у взрослых в условиях стационара. Генерал Хосп Психиатрия . 2008; 30: 67–72. [Бесплатная статья PMC] [PubMed] [Google Scholar]51. Альбертини Р. С., Филлипс К.А., Гевремон Д. Дисморфическое расстройство тела у маленького ребенка (письмо) J Am Acad Детская подростковая психиатрия .1996; 35: 1425–1426. [PubMed] [Google Scholar]52. Филлипс К.А., Диас С.Ф. Половые различия в телесном дисморфическом расстройстве. J Нерв Мент Дис . 1997; 185: 570–577. [PubMed] [Google Scholar]53. Филлипс К.А., Менар В., Фэй С. Гендерные сходства и различия у 200 человек с дисморфическим расстройством тела. Компр Психиатрия . 2006; 47:77–87. [Бесплатная статья PMC] [PubMed] [Google Scholar]54. Диди Э.Р., Менар В., Стерн А.П., Филлипс К.А. Профессиональное функционирование и нарушения у взрослых с дисморфическим расстройством тела. Компр Психиатрия . 2008; 24:26–28. [PubMed] [Google Scholar]55. Филлипс К.А., Менард В., Фэй С., Вайсберг Р. Демографические характеристики, феноменология, сопутствующие заболевания и семейный анамнез у 200 человек с дисморфическим расстройством тела. Психосоматика . 2005; 46: 317–325. [Бесплатная статья PMC] [PubMed] [Google Scholar]56. Папа Х.Г., младший Грубер А.Дж., Чой П., Оливардия Р., Филлипс К.А. Мышечная дисморфия: малоизвестная форма дисморфического расстройства тела. Психосоматика . 1997; 38: 548–557.[PubMed] [Google Scholar]57. Оливардия Р., Папа Х.Г., младший. Хадсон Дж.Л. Мышечная дисморфия у мужчин-тяжелоатлетов: исследование случай-контроль. Am J Психиатрия . 2000;157:1291–1296. [PubMed] [Google Scholar]58. Папа К.Г., Папа Х.Г., Менар В., Фэй С., Оливардия Р., Филлипс К.А. Клинические особенности мышечной дисморфии у мужчин с дисморфией тела. Изображение тела . 2005; 2: 395–400. [Бесплатная статья PMC] [PubMed] [Google Scholar]59. Эйзен Дж.Л., Филлипс К.А., Баер Л., Бир Д.А., Атала К.Д., Расмуссен С.А.Шкала оценки убеждений Брауна: надежность и валидность. Am J Психиатрия . 1998; 155:102–108. [PubMed] [Google Scholar] 60. Филлипс К.А., Менар В., Пагано М.Е., Фэй С., Стаут Р.Л. Бредовое и небредовое дисморфическое расстройство тела: клинические особенности и течение болезни. J Психиатр Res . 2006; 40:95–104. [Бесплатная статья PMC] [PubMed] [Google Scholar]61. Эйзен Дж.Л., Филлипс К.А., Коулз М.Е., Расмуссен С.А. Взгляд на обсессивно-компульсивное расстройство и телесное дисморфическое расстройство. Компр Психиатрия . 2004; 45:10–15. [Бесплатная статья PMC] [PubMed] [Google Scholar]62. Филлипс К.А. Психоз при телесном дисморфическом расстройстве. J Психиатр Res . 2004; 38: 63–72. [PubMed] [Google Scholar]63. Филлипс К.А., Гандерсон К.Г., Малья Г., МакЭлрой С.Л., Картер В. Сравнительное исследование дисморфического расстройства тела и обсессивно-компульсивного расстройства. Дж. Клин Психиатрия . 1998; 59: 568–575. [PubMed] [Google Scholar]64. Veale D, Riley S. Зеркало, зеркало на стене, кто из них самый уродливый? Психопатология смотрения в зеркало при телесном дисморфическом расстройстве. Behav Res Ther . 2001; 39: 1381–1393. [PubMed] [Google Scholar]65. Фойснер Д.Д., Хембахер Э., Филлипс К.А. Мышь, которая не могла перестать мыться: патологический уход за животными и людьми. ЦНС Спектр . 2009; 14: 503–513. [Бесплатная статья PMC] [PubMed] [Google Scholar]67. Грант Дж. Э., Менар В., Филлипс К.А. Патологическое ковыряние кожи у лиц с дисморфическим расстройством тела. Генерал Хосп Психиатрия . 2006; 28: 487–493. [Бесплатная статья PMC] [PubMed] [Google Scholar]68. О’Салливан Р.Л., Филлипс К.А., Кютен Н.Дж., Вильгельм С.Почти смертельный ковыряние кожи от бредового дисморфического расстройства тела, реагирующего на флувоксамин. Психосоматика . 1999; 40:79–81. [PubMed] [Google Scholar]69. Филлипс К.А., Тауб С.Л. Кожное ковыряние как симптом телесного дисморфического расстройства. Психофармаколь Бык . 1995; 31: 279–288. [PubMed] [Google Scholar]70. Келли М., Уолтерс С., Филлипс К. Социальная тревожность и ее связь с функциональными нарушениями при телесном дисморфическом расстройстве. Поведение Тер . 2010;41:143–153. [PubMed] [Google Scholar]72.Veale D. Успехи в когнитивно-поведенческой модели телесного дисморфического расстройства. Изображение тела . 2004; 1:113–125. [PubMed] [Google Scholar]74. Филлипс К.А., Пагано М.Е., Менар В., Стаут Р.Л. 12-месячное последующее исследование течения телесного дисморфического расстройства. Am J Психиатрия . 2006; 163: 907–912. [Бесплатная статья PMC] [PubMed] [Google Scholar]75. Филлипс К.А., Пагано М.Е., Менар В., Фэй С., Стаут Р.Л. Предикторы ремиссии дисморфического расстройства тела: проспективное исследование. J Нерв Мент Дис .2005; 193: 564–567. [Бесплатная статья PMC] [PubMed] [Google Scholar]76. Филлипс К.А. Качество жизни пациентов с дисморфофобией. J Нерв Мент Дис . 2000; 188:170–175. [PubMed] [Google Scholar]77. Филлипс К.А., Менар В., Фэй С., Пагано М.Э. Психосоциальное функционирование и качество жизни при телесном дисморфическом расстройстве. Компр Психиатрия . 2005; 46: 254–260. [Бесплатная статья PMC] [PubMed] [Google Scholar]78. Филлипс К.А., Куинн Г., Стаут Р.Л. Функциональные нарушения при дисморфическом расстройстве тела: проспективное последующее исследование. J Психиатр Res . 2008; 42: 701–707. [Бесплатная статья PMC] [PubMed] [Google Scholar]80. Филлипс К.А., Коулз М.Е., Менар В., Йен С., Фэй С., Вайсберг Р.Б. Суицидальные мысли и попытки самоубийства при телесном дисморфическом расстройстве. Дж. Клин Психиатрия . 2005; 66: 717–725. [PubMed] [Google Scholar]81. Вил Д., Букок А., Гурней К., Драйден В. Дисморфическое расстройство тела: обзор пятидесяти случаев. Бр J Психиатрия . 1996; 169:196–201. [PubMed] [Google Scholar]83. Harris EC, Barraclough B. Самоубийство как исход психических расстройств: метаанализ. Бр J Психиатрия . 1997; 170: 205–228. [PubMed] [Google Scholar]84. Перуги Г., Акискал Х.С., Джаннотти Д., Фраре Ф., Ди Вайо С., Кассано Г.Б. Гендерные различия в дисморфофобии тела (дисморфофобия) J Nerv Ment Dis . 1997; 185: 578–582. [PubMed] [Google Scholar]85. Сарвер БД. Осведомленность и идентификация эстетических хирургов о дисморфическом расстройстве тела: результаты опроса американского общества членов эстетической пластической хирургии. Эстет Сург J . 2002; 22: 531–535.[PubMed] [Google Scholar]86. Грант Дж. Э., Менар В., Пагано М. Э., Фэй С., Филлипс К. А. Расстройства, связанные с употреблением психоактивных веществ, у лиц с телесным дисморфическим расстройством. Дж. Клин Психиатрия . 2005; 66: 309–316. [Бесплатная статья PMC] [PubMed] [Google Scholar]87. Альбертини Р.С., Филлипс К.А. 33 случая телесных дисморфических расстройств у детей и подростков. J Am Acad Детская подростковая психиатрия . 1999; 38: 453–459. [PubMed] [Google Scholar]88. Филлипс К.А., Диди Э.Р., Менар В., Пагано М.Э., Фэй С., Вайсберг Р.Б.Клинические особенности дисморфофобии тела у подростков и взрослых. Психиатрия рез. . 2006; 141:305–314. [Бесплатная статья PMC] [PubMed] [Google Scholar]89. Филлипс К.А., Атала К.Д., Альбертини Р.С. Дисморфическое расстройство тела у подростков. J Am Acad Детская подростковая психиатрия . 1995; 34: 1216–1220. [PubMed] [Google Scholar]90. Калл Дж., Гилл В. Шкала вероятности самоубийства. Лос-Анджелес, Калифорния: WPS . 1982 [Google Scholar]91. Декерсбах Т., Сэвидж К.Р., Филлипс К.А. и др. Особенности нарушения памяти при телесном дисморфическом расстройстве. J Int Neuropsychol Soc . 2000; 6: 673–681. [PubMed] [Google Scholar]92. Фойснер Дж. Д., Таунсенд Дж., Быстрицкий А., Букхаймер С. Визуальная обработка информации о лицах при дисморфическом расстройстве тела. Главный врач общей психиатрии . 2007;64:1417–1425. [PubMed] [Google Scholar]93. Buhlmann U, Reese HE, Renaud S, Wilhelm S. Клинические соображения по лечению телесного дисморфического расстройства с помощью когнитивно-поведенческой терапии. Изображение тела . 2008; 5:39–49. [PubMed] [Google Scholar]94.Бульманн У., Эткофф Н.Л., Вильгельм С. Предвзятость распознавания эмоций из-за презрения и гнева при телесном дисморфическом расстройстве. J Психиатр Res . 2006; 40:105–111. [PubMed] [Google Scholar]95. Buhlmann U, McNally RJ, Etcoff NL, Tuschen-Caffier B, Wilhelm S. Дефицит распознавания эмоций при дисморфическом расстройстве тела. J Психиатр Res . 2004; 38: 201–206. [PubMed] [Google Scholar]96. Раух С.Л., Филлипс К.А., Сегал Э. и др. Предварительное морфометрическое магнитно-резонансное исследование регионарных объемов головного мозга при телесном дисморфическом расстройстве. Психиатрия рез. . 2003; 122:13–19. [PubMed] [Google Scholar]97. Атмака М., Бингол И., Айдын А. и др. Морфология головного мозга пациентов с дисморфическим расстройством тела. J Аффективное расстройство . 2009; 123:701–707. [Google Академия]98. Фойснер Дж. Д., Таунсенд Дж., Быстрицкий А., МакКинли М., Моллер Х., Букхаймер С. Региональные объемы мозга и тяжесть симптомов при дисморфическом расстройстве тела. Психиатрия рез. . 2009; 172: 161–167. [Бесплатная статья PMC] [PubMed] [Google Scholar]99. Кэри П., Сидат С., Уорвик Дж., Ван Херден Б., Стейн Д.Дж.ОФЭКТ-визуализация дисморфического расстройства тела. J Нейропсихиатрия Clin Neurosci . 2004; 16: 357–359. [PubMed] [Google Scholar] 100. Фойснер Дж. Д., Муди Т., Хембахер Э. Аномалии зрительной обработки и лобно-полосатой системы при дисморфическом расстройстве тела. Главный врач общей психиатрии . В прессе [бесплатная статья PMC] [PubMed] [Google Scholar]101. Rotge JY, Guehl D, Dilharreguy B, et al. Метаанализ изменений объема мозга при обсессивно-компульсивном расстройстве. Биол Психиатрия . 2009;65:75–83.[PubMed] [Google Scholar] 102. Креранд К.Э., Филлипс К.А., Менар В., Фэй К. Непсихиатрическое лечение телесного дисморфического расстройства. Психосоматика . 2005; 46: 549–555. [Бесплатная статья PMC] [PubMed] [Google Scholar]103. Филлипс К.А., Грант Дж., Синискалчи Дж., Альбертини Р.С. Хирургическое и непсихиатрическое лечение больных с телесными дисморфическими расстройствами. Психосоматика . 2001; 42: 504–510. [PubMed] [Google Scholar] 104. Ипсер Дж., Сандер С., Штейн Д. Фармакотерапия и психотерапия телесного дисморфического расстройства.Доступно по адресу: http://mrw.interscience. wiley.com/cochrane/clsysrev/articles/CD005332/abstract.html. Кокрановская система базы данных, версия . По состоянию на 24 мая 2010 г. [бесплатная статья PMC] [PubMed] [Google Scholar] 105. Обсессивно-компульсивное расстройство: основные вмешательства в лечении обсессивно-компульсивного расстройства и телесного дисморфического расстройства. Национальный институт здоровья и клинического мастерства . По состоянию на 24 мая 2010 г. Доступно по адресу: http://www.nice.org.uk/nicemedia/pdf/cg031niceguideline.pdf. [PubMed] [Google Scholar] 106.Холландер Э., Аллен А., Квон Дж. и др. Перекрестное исследование кломипрамина и дезипрамина при дисморфическом расстройстве тела: селективная эффективность ингибитора обратного захвата серотонина при воображаемом уродстве. Главный врач общей психиатрии . 1999;56:1033–1039. [PubMed] [Google Scholar] 107. Перуджи Г., Джаннотти Д., Ди Вайо С., Фраре Ф., Сэттони М., Кассано Г.Б. Флувоксамин в лечении дисморфофобии (дисморфофобии) Int Clin Psychopharmacol . 1996; 11: 247–254. [PubMed] [Google Scholar] 109. Филлипс К.А., Дуайт М.М., МакЭлрой С.Л.Эффективность и безопасность флувоксамина при дисморфофобии. Дж. Клин Психиатрия . 1998; 59: 165–171. [PubMed] [Google Scholar] 110. Филлипс К.А., Наджар Ф. Открытое исследование циталопрама при дисморфическом расстройстве организма. Дж. Клин Психиатрия . 2003; 64: 715–720. [PubMed] [Google Scholar] 111. Филлипс К.А., Альбертини Р.С., Расмуссен С.А. Рандомизированное плацебо-контролируемое исследование флуоксетина при дисморфофобии. Главный врач общей психиатрии . 2002; 59: 381–388. [PubMed] [Google Scholar] 112.Hollander E, Cohen LJ, Simeon D, Rosen J, deCaria CM, Stein D. Лечение флувоксамином дисморфофобии. J Clin Psychopharmacol . 1994; 14:75–77. [PubMed] [Google Scholar] 113. Холландер Э., Либовиц М.Р., Винчел Р., Клумкер А., Кляйн Д.Ф. Лечение телесно-дисморфического расстройства блокаторами обратного захвата серотонина. Am J Психиатрия . 1989; 146: 768–770. [PubMed] [Google Scholar] 114. Филлипс К.А. Открытое исследование увеличения буспироном ингибиторов обратного захвата серотонина при дисморфическом расстройстве организма. Психофармаколь Бык . 1996; 32: 175–180. [PubMed] [Google Scholar] 115. Филлипс К.А., Альбертини Р.С., Синискалчи Дж.М., Хан А., Робинсон М. Эффективность фармакотерапии дисморфического расстройства тела: обзорное исследование. Дж. Клин Психиатрия . 2001; 62: 721–727. [PubMed] [Google Scholar] 116. Филлипс К.А., Расмуссен С.А. Изменение психосоциального функционирования и качества жизни пациентов с дисморфическим расстройством тела, получавших флуоксетин: плацебо-контролируемое исследование. Психосоматика .2004; 45: 438–444. [Бесплатная статья PMC] [PubMed] [Google Scholar]117. Грант Дж. Э. Успешное лечение небредового дисморфического расстройства тела оланзапином: клинический случай. Дж. Клин Психиатрия . 2001; 62: 297–298. [PubMed] [Google Scholar] 118. Накааки С. , Мурата Ю., Фурукава Т.А. Эффективность оланзапина в сочетании с терапией пароксетином у пациентов с тяжелым дисморфическим расстройством организма. Психиатрия Clin Neurosci . 2008;62:370. [PubMed] [Google Scholar] 119. Филлипс К.А. Плацебо-контролируемое исследование усиления пимозидом флуоксетина при дисморфическом расстройстве организма. Am J Психиатрия . 2005; 162: 377–379. [Бесплатная статья PMC] [PubMed] [Google Scholar]121. Аллен А., Хэдли С.Дж., Каплан А. и др. Открытое исследование венлафаксина при дисморфофобии. ЦНС Спектр . 2008; 13: 138–144. [PubMed] [Google Scholar] 123. Veale D, Gournay K, Dryden W, et al. Дисморфическое расстройство тела: когнитивно-поведенческая модель и пилотное рандомизированное контролируемое исследование. Behav Res Ther . 1996; 34: 717–729. [PubMed] [Google Scholar] 124. Вильгельм С., Отто М.В., Лор Б., Декерсбах Т.Когнитивно-поведенческая групповая терапия при телесном дисморфическом расстройстве: серия случаев. Behav Res Ther . 1999; 37:71–75. [PubMed] [Google Scholar] 125. Филлипс К.А., Диди Э.Р., Фойснер Дж., Вильгельм С. Дисморфическое расстройство тела: лечение нераспознанного расстройства. Am J Психиатрия . 2008; 165:1111–1118. [Бесплатная статья PMC] [PubMed] [Google Scholar]126. Вильгельм С., Филлипс К.А., Стекети Г. Руководство по когнитивно-поведенческой терапии дисморфического расстройства тела. Нью-Йорк, штат Нью-Йорк: Guilford Press. В прессе [Google Академия] 127.Маркс И.М., Мишан Дж. Избегание дисморфофобии с нарушением телесного восприятия: пилотное исследование экспозиционной терапии. Бр J Психиатрия . 1988; 152: 674–678. [PubMed] [Google Scholar] 128. Незироглу Ф., Хемлани-Патель С. Обзор когнитивного и поведенческого лечения телесного дисморфического расстройства. ЦНС Спектр . 2002; 7: 464–471. [PubMed] [Google Scholar] 129. Незироглу Ф., Маккей Д., Тодаро Дж., Ярюра-Тобиас Дж.А. Влияние когнитивно-поведенческой терапии на людей с дисморфическим расстройством тела и сопутствующим диагнозом Оси II. Поведение Тер . 1996; 27: 67–77. [Google Академия] 130. Маккей Д. Двухлетнее наблюдение за поведенческим лечением и поддержанием телесного дисморфического расстройства. Изменение поведения . 1999; 23: 620–629. [PubMed] [Google Scholar] 131. Розен Дж. К., Рейтер Дж., Оросан П. Когнитивно-поведенческая терапия образа тела при телесном дисморфическом расстройстве. J Consult Clin Psychol . 1995; 63: 263–269. [PubMed] [Google Scholar] 132. Миллер В. Р., Роллник С. Мотивационное интервьюирование: подготовка людей к изменению аддиктивного поведения.Нью-Йорк, штат Нью-Йорк: Guilford Press . 1991 [Google Scholar] 133. Диди Э.Р., Курахара Л., Менар В., Филлипс К.А. Соблюдение рекомендаций по когнитивно-поведенческой терапии и фармакотерапии у пациентов с телесным дисморфическим расстройством. Плакат представлен на ежегодном собрании Ассоциации поведенческой и когнитивной терапии, ноябрь 2008 г., Орландо, Флорида [Google Scholar]134. Didie ER, Tortolani CC, Pope CG, Menard W, Fay C, Phillips KA. Жестокое обращение и пренебрежение в детстве при дисморфическом расстройстве тела. Жестокое обращение с детьми Negl .2006; 30:1105–1115. [Бесплатная статья PMC] [PubMed] [Google Scholar]135. Didie ER, Loerke E, Menard W, Phillips KA. Серьезность межличностных проблем у людей с телесным дисморфическим расстройством. Постер представлен на: ежегодном собрании Отдела оценки новых клинических лекарств NIMH; 2008 г.; Феникс, Аризона [Google Scholar] 136. Керман Г.Л., Вейсманн М.М., Рузанвиль Б.А., Шеврон Э.С. Межличностная психотерапия депрессии. Нью-Йорк, штат Нью-Йорк: основные книги . 1984 [Google Scholar] 137. Фэрберн К.Г. Межличностная терапия нервной булимии.В: Гарнер Д.М., Гарфинкель П.Е., ред. Справочник по лечению расстройств пищевого поведения . Нью-Йорк, штат Нью-Йорк: Guilford Press 1997: 67–93. [Google Академия] 138. Диди Э.Р., Филлипс К.А. Межличностная психотерапия телесного дисморфического расстройства: экспериментальное исследование. Постер представлен на ежегодном собрании Международного общества межличностной психотерапии, март . 2009 Нью-Йорк, штат Нью-Йорк. [Академия Google]

Грузовик с задней дверью. Доступно в вашем магазине CarMax Renton, WA. 1973-87 Полноразмерный задний канал двери грузовика Chevy и GMC, левый.5 колес, 10 адаптеров, шины Continental. Эти накладки на пороги задних дверей изготовлены из 100% нержавеющей стали с полированной/матовой поверхностью. Все наши запасные окна для задних дверей Chevy Silverado 1500 2004 года поставляются с 1-летней гарантией, БЕСПЛАТНОЙ доставкой и 30-дневной гарантией возврата денег. Найдите дверные панели автомобилей и грузовиков для моделей 1980-х и 1990-х годов или почините автомобили, выпущенные в 2017 году. Топливо: газ. Наши сменные дверные панели идеально подходят для ремонта новых моделей. 1973-79 Уплотнители дверей можно использовать на задней двери кабины экипажа.р.-фут. Это как GM сделал это! Панельный грузовик Chevy 51 года: левая задняя дверь сарая пришла с разобранным запорным механизмом и выброшена в коробку. Чердак мамы для дополнительного места для хранения, низкая погрузочная рампа и 2 боковых молдинга кузова – молдинги дверей автомобиля, молдинги бампера, молдинги колесных арок, защитные кромки дверей, окрашенные молдинги дверей и другая защитная отделка дверей автомобиля для защиты вашего автомобиля или грузовик от повреждений на парковке, вмятин на дверях и сколов. Кабина High XR — опции для багажника на крыше и дистанционного доступа без ключа.Каждая деталь обладает прочностью, гибкостью и устойчивостью к ультрафиолетовому излучению, поэтому она не деформируется, не отслаивается и не выцветает при длительном использовании в жестких условиях. Убедитесь, что все возможности разморозки или технологические возможности работают. Запатентованная петля центрального шарнира устраняет защемление и повышает прочность. Среднеразмерный грузовик Chevy Colorado 2022 года, доступный с дизельным двигателем, предлагает смелую эстетику и задний бампер, крышки зеркал и дверные ручки в цвет кузова; Дети находятся в большей безопасности, если они правильно закреплены на заднем сиденье в соответствующем детском удерживающем устройстве.У меня есть фабрика 8. Вы можете быть уверены, что в D & D Garage Doors дверь вашего грузовика отремонтируют должным образом. Присоединился 20 апр. 2009 г. Добавить в корзину Сравнить. Навесы ATC LEX для грузовиков LEX — это навес премиум-класса ATC для грузовиков высотой до кабины, придающий вашему грузовику вид внедорожника с четкими линиями и элегантным стилем. ХАГМ-ОВХ. Изготовлен из высокопрочного легкого алюминия. И найдите другие изображения в библиотеке роялти-фри стоковых изображений iStock, содержащих фотографии вида сзади, которые можно быстро и легко загрузить. Close Window Запчасти и аксессуары для грузовиков Ford F-100 1948-52 F1 и 1953, 1954, 1955 и 1956 гг. Занавески для задних дверей Randall идеально подходят для защиты трейлера от ветра, тепла, пыли, насекомых и мусора.141 доллар. Ключевая особенность. Эти типы профилактического покрытия Купить высококачественное подержанное стекло задней двери Chevy Silverado 1500 2004 года дешево и быстро. Palomino HS-2912 2022 года — это кемпер с жестким бортом, нескользящим, с мокрой ванной и задним патио для длинномерных грузовиков. Коммерческая обложка 100RCC и 180CC — повысьте уровень своего бизнеса. Они гарантируют, что транспортные средства работают лучше и имеют более длительный срок службы. Мягкая окантовка по краю дверных протекторов для дополнительной защиты вашего автомобиля. 2002 только 1500, 2003-2009 все. Мы можем сделать специальные размеры заказа также. Задние замки не поддаются (приходится открывать вручную). Опять же в табличке АБС. Удаление. -Высота проема задней двери 5 футов 11 дюймов – Ширина проема задней двери 6 футов – Боковая дверь RV 32 дюйма с замком и замком (двери ручной сборки не провисают) – Двойные задние двери – Стены из фанеры 3/8 дюйма – Фанера 3/4 дюйма напольный 12-вольтовый светодиодный плафон с парой выключателей бокового вентиляционного отверстия… 2007. У грузовика Ford® F-150 2021 года не бывает выходных. Защитная накладка на дверь быстро и легко устанавливается с помощью 3 защелкивающихся фиксаторов вдоль 200 миллионов бывших в употреблении автозапчастей, доступных для мгновенного поиска.1948-1952 Автофургон Форд. В большинстве случаев для грузовиков наиболее предпочтительны распашные двери. КАК УХОДИТЬ ЗА НАКЛЕЙКОЙ НА ЗАДНЕЕ ОКНО? Все наклейки на окна грузовиков можно мыть обычным мылом и водой. 7. ) Выберите из нашего ассортимента дверных защелок для грузовиков, включая многоточечные защелки с лопастной ручкой, многоточечные защелки с Т-образной ручкой и многое другое. Преобразование 6-дверного MEGA X 2 за 39 000 долларов. 53. 24 фута. Оригинальная отделка и молдинги не могут быть повторно использованы с этими панелями. Такие двери изначально использовались в конных экипажах, но редко встречаются в современных транспортных средствах, в первую очередь потому, что они воспринимаются как менее безопасные, чем дверь с передними петлями.99 шт. Внизу дверной панели. Установка. 1992. 29 998 долларов США • 29 тыс. миль. Это помогает предотвратить попадание воды на механизм дверной защелки и продлевает его срок службы. C. • Обшивка задней двери, подогнанная под размер задней двери • Толстая сотовая усиленная крыша • Выбор окрашенной отделки или края без отделки • Доступны дополнительные системы багажника на крыше • Ограниченная пожизненная гарантия на краску и структуру • Все те же функции ICON, но с наружной распашной задней дверью для грузовиков старшего поколения 4 F-150 (1980 г. – настоящее время) SuperCrew = 4 полноразмерные двери (2001 г. – настоящее время) SuperCab = 2 полноразмерные двери и 2 самодельные двери или просто задний уголок со складыванием -раскладывающиеся сиденья (2001 – н. в.) обычная кабина = 2 полноразмерные двери.Кабина High R — прочная, надежная и экономичная. Мы также добавили его распространенные причины и признаки неисправной дверной защелки. В стандартную комплектацию High C входят затемненные боковые раздвижные окна с экранами, третий светодиодный стоп-сигнал, переднее окно и задняя дверь с двойным замком. Квадратные угловые петли из ламинированной стали (4) Все стальные петли имеют двойное или тройное ламинирование для большей прочности. 00. 1967-72 Chevy & GMC truck, Blazer, Jimmy, Suburban или Panel Truck Задняя дверная стойка подходит только к передним дверям Suburban (… Разное.Этот ремонт выполняется в одном из наших офисов, так как для него требуются специальные инструменты и детали, которые наши повседневные техники не берут с собой в дорогу. Подходит для автомобилей (и/или) Дополнительная информация Модель: F100 Это запасные задние дверные панели, а не репродукции оригиналов. FEMALE DOOR LOVETAIL BUMPERS ’33-’36 Passenger, ’36-’46 Truck, Hard Rubber Bonded to Metal 1992-1997 Ford F-Series Truck Панель левой задней двери Мокко Ручные окна/замки. Я только что установил динамики Infinity Reference в передние двери и приборную панель своего большого рога 2021 года.Расположенная в прекрасных горах Кларксбурга, Западная Вирджиния, компания Rasco Used Truck Parts гордится тем, что является крупнейшей в Западной Вирджинии компанией по переработке подержанных запчастей для грузовиков Chevrolet, Dodge, Ford и Toyota; площадью более 75 акров. Мы производим кузова фургонов/прямых грузовиков класса 3–7 (GVW) для обслуживания рынков сухих грузов и охлажденных продуктов, а также широкий спектр специальных кузовов для обслуживания фермеров, владельцев ранчо, подрядчиков, ландшафтных дизайнеров, транспортных средств и транспортных средств. , частный/муниципальный … Чтобы найти заднюю дверь для пикапа GMC 2500 в ближайшем к вам переработчике, просто введите ГОД своего автомобиля и свой почтовый индекс в форму выше и нажмите кнопку «НАЙТИ».1967-79 Уплотнители дверей устанавливаются на кабину. Приводы дверных замков на грузовиках 2007 года и выше — полная чушь и постоянно выходят из строя. 31. Это костяк пикапа, и он построен более мощно, чем стандартный автомобиль, чтобы справиться с нагрузкой и требует, чтобы пикап бросился на него. King Cab на Frontier имеет четыре двери, но задние двери не имеют внешней ручки — их нужно открывать и закрывать при открытой передней двери. Марка грузовика. Металлический канал, который крепится внутри в задней части дверной коробки и направляет дверное стекло вашего Chevy & GMC Truck вверх и вниз.1973-89 Полноразмерные алюминиевые накладки на пороги для грузовиков Chevy и GMC, передние, кабина экипажа, комплект. Грузовики с двойной кабиной могут быть оснащены пятью или шестью кабинами. LEER 100XL с боковыми окнами в стиле внедорожников и безрамной задней дверью с гнутым стеклом устанавливает стандарт производительности и стиля. Автомобили и грузовики серии BMW X5; Открытые вопросы: 0 ответов. 25 долларов. Здесь, в Speedy Signs, грузовики-трансформеры — наша страсть. 1993. У них четыре обычные двери и два ряда сидений, как у грузовика с двойной кабиной, но задние двери и сиденья меньше, как у грузовика с удлиненной кабиной. Как отремонтировать замок задней двери на Ford F150? Отремонтировать замок задней двери в Ford F-150 можно двумя способами. Сэкономьте 32 доллара. Модель грузовика. 26 долларов. RES25JEPDM 25 ‘J’ Уплотнитель двери грузовика – черный каучук EPDM, одинарный. Стальная кулачковая дверная защелка с защелкой шириной 2 дюйма идеально подходит для небольших закрытых грузовых прицепов. 5-дюймовый WB: 1 922 19 408 43 987 Дверные панели, зажимы дверных панелей, дверные детали и устаревшие детали для классических грузовиков Chevy и грузовиков GMC от Classic Parts of Америка. Задние двери Мерседес Бенц Спринтер 2500 2012 года.92. Мы производим кузова крытых/прямых грузовиков класса 3–7 (GVW) для обслуживания рынков сухих грузов и охлажденных продуктов, а также широкий спектр специальных кузовов для обслуживания фермеров, владельцев ранчо, подрядчиков, ландшафтных дизайнеров, оборудования и материалов. -тягачи, частные/муниципальные … RETRAC 409924 Высотные складывающиеся задние подножки для полуприцепов с автоматической укладкой, подходит для 4-дюймового бампера, сталь, 600 фунтов, полуприцепы, автофургоны 4. У нас есть книги запчастей Mopar, руководства по обслуживанию Dodge и Hollander Инструкции по замене грузовиков Dodge 1961-2006 гг.Запасная прокладка задней двери из этилен-пропиленового каучука твердостью 70 для цистерн вакуумных грузовиков типа Ibex и многих других изготавливается из уплотнительного материала EPDM коммерческого класса твердостью 70, предназначенного для применений, требующих твердой резины, подходящей для наружных условий. Дурбан: +27 (0) 860 002 080. Поднимите свой грузовик на ступеньку выше с нашим 100XR, предлагающим вам основные преимущества нашего 100R плюс боковые борта и изогнутую полностью стеклянную заднюю дверь с установленной по центру поворотной системой защелки LEER. Йоханнесбург: +27 (0) 860 008 080.Прокладка имеет длину 21 фут. Чернить; Кожух закрывает кабели на задней двери корпусов кемперов Leer 100XL, 100XR и 100XQ из стекловолокна; ок. Покрывало, спутниковое радио, датчики парковки, камера заднего вида, легкосплавные диски, дополнительный аудиовход. Компоненты дверей 1948-52 F1 F2 F3. $ 116. Мы постараемся сделать это максимально простым для вас. 76. Внутренняя длина этажа Palomino HS-2912 составляет 10 футов 8 дюймов, патио — 6 футов 7 дюймов, а внутренняя высота — 6 футов 6 дюймов. Комплект уплотнений задней двери панельного грузовика. 3л. . Кроме того, это единственный полноразмерный грузовик на рынке, у которого меньше места над головой, чем у Ram 38.Пустой вес: 7860 фунтов. Я не собираюсь добавлять усилитель или менять радио. Утвержденное безопасное стекло • Утопленная бескаркасная задняя дверь из тонированного стекла с ручкой-замком в форме капли • Полураздвижные боковые окна в алюминиевой раме с экраном • Индивидуальный дизайн • L. Заброшенная дверь на любом из грузовиков вашего автопарка также может быть проблемой безопасности. 6 метров в длину. Показывать только этого пользователя. В наличии и готов к отправке. 12 дюймов в длину и 2 дюйма в ширину; Приклеивается с помощью автомобильной ленты 3M Morgan Truck Body уже 70 лет является ведущим производителем кузовов для грузовиков и фургонов в Северной Америке. Версия Crew Cab с полноразмерными задними дверями и рядом задних сидений может вместить 5 человек. Тент LER высотой с кабину грузовика имеет такую ​​же гладкую цельностеклянную заднюю дверь и одинарный замок, как и LEX, но с увеличенными боковыми раздвижными окнами для максимальная вентиляция. -Высота проема задней двери 5 футов 11 дюймов – Ширина проема задней двери 6 футов – Боковая дверь RV 32 дюйма с замком и замком (двери ручной сборки не провисают) – Двойные задние двери – Стены из фанеры 3/8 дюйма – Фанера 3/4 дюйма напольный 12-вольтовый светодиодный плафон с парой выключателей боковых вентиляционных отверстий … 2022 Palomino HS-2912 Технические характеристики.В новом стеллаже для шин используются заводские болты и НЕ требуется СВЕРЛЕНИЕ двери. Нужно немного дополнительного места? Купите 17-футовый автофургон V-10, Ford E450 и используйте его для личных или деловых нужд. Фургоны-фургоны для перевозки грузов, товаров, мебели и строительных материалов. Однако, как правило, винты необходимо удалить в следующих местах: Под панелью паруса. Уличный стержень, часть №. Пассажирские двери 4. Ознакомьтесь со стандартными функциями и интересными опциями для Ford® Super Duty® F-250 XLT 2022 года.C СТОПОР ЦЕНТРАЛЬНОЙ ДВЕРИ ПОДЛОКОТНИКА ЗАДНЕГО СИДЕНЬЯ Toyota Truck Просмотр СТОПОР ДВЕРИ ЦЕНТРАЛЬНОГО ПОДЛОКОТНИКА ЗАДНЕГО СИДЕНЬЯ для вашего грузовика Toyota. Эта прокладка имеет 1,24-футовый ящик для передвижного фургона с удлинителем кабины, складную дверь 91 дюйм, внутреннюю высоту 97 дюймов, ширину 102 дюйма. Чтобы узнать детали, позвоните по следующему номеру. Удалите поврежденное стекло. Модели Cargo Express шириной 5 футов XL оснащены двумя стандартными вариантами задней двери — пандусом или одностворчатой ​​дверью. Количество: 2 шт. Автофургоны, также известные как сухие фургоны, представляют собой легкие, средние и тяжелые грузовики с отсеком для хранения, отделенным от кабины.Повышенный комфорт оператора повышает производительность и концентрацию. ПАНЕЛЬ В СБОРЕ, ЗАДНЯЯ ДВЕРЬ, ПРАВ. Примечания по установке: Для установки этих колонок необходимо просверлить и вырезать отверстия в дверной панели. 4. Dodge Ram 3500 Mega Cab 2013 года стоимостью 40 000 долларов. Компоненты дверей 1999-16 F250 F350 F450 F550 Super Duty. Радио с 4 экранами. Может кто-нибудь дать ссылку или инструкции, как собрать эту кучу деталей? У него есть верхняя защелка, нижняя защелка и центральная ручка, а также пара соединительных винтов длиной около 18 дюймов.Листовой металл 1955–1959 Ремонт нижней двери 1947–1954 Установка угловой панели кабины 1955–1959 Установка угловой панели кабины 1955–1959 Установка приборной панели Chevy 1955–1959 Внутренняя подножка и коромысло 1955–1959 Установка подножки и гладкой панели приборов 1967–1972 Замена листового металла Внутренний ковер Установка чехла сиденья и установка подлокотника 1947… Расход бензина 15 миль на галлон по городу/22 мили на галлон по шоссе. Дополнительная информация. Я могу построить вам один. Привод возвращает дверной замок с электроприводом в надлежащее состояние. Прямая замена для правильной установки каждый раз. Высококачественный электродвигатель. Благодаря удлинению задней стенки двери в стиле амбара можно сделать более узкими. 29 отзывов Зеркало заднего вида, Универсальное зеркало заднего вида для грузовиков Регулируемое внутреннее зеркало заднего вида с присоской, 220*65 мм A. Они являются авторизованными дилерами Leer, Unicover и Ranch и продают запчасти для крышек грузовиков нескольких различных марок. Кейптаун: +27 (0) 21 939 0021. ком. Подробности. Восстановите простоту и удобство удаленного запирания или отпирания любой из дверей вашего автомобиля с помощью привода дверного замка Dorman. 2-точечная запорная система для тяжелых условий эксплуатации используется на задних дверях грузовиков из стекловолокна и алюминия.Подержанная дверь со стороны пассажира, задние двери Chevy Astro, дверь Ford LNT8000 и LT8000, подержанные двери Ford Aerostar, двери Mack MS200, подержанная дверь панельного грузовика Kurbmaster, подержанная Ford E250… Четырехдверный пикап Toyota Tundra отстает от Ram на целых 3 дюйма. 1500, а это 42. 67! Повышенный комфорт оператора благодаря мощной системе мощностью 40 000 БТЕ даже при открытой задней двери. Вставьте новое заднее стекло. Фитинг. ВОЗВРАТ И ГАРАНТИЯ… Amthor International предлагает широкий выбор вакуумных цистерн в линейке Matador, включая варианты кодовых и некодовых цистерн со стационарными или самосвальными и полностью открывающейся задней дверью.Длина: 66-7/16 дюймов. Описание: Подержанный Chevrolet Colorado LT 2022 Kenworth T680 2018 года с 156-дюймовым ARI Legacy Sleeper, задней кроватью с боковой дверью (белый грузовик) 320-дюймовый WB Stock # 124273 ARI 2187. колпаки для грузовиков, затем мы даем вам параллельное сравнение некоторые из наиболее популярных моделей крышек для грузовиков и крышек для грузовых автомобилей, чтобы вы могли сами увидеть разницу. Б/у дверь со стороны пассажира, задние двери Chevy Astro, двери Ford LNT8000 и LT8000, б/у двери Ford Aerostar, двери Mack MS200, б/у дверь панельного грузовика Kurbmaster, б/у Ford E250… Swing Rear Doors, 47.Номер продукта: gm1227604533 $ 33. Замки включают центральный кулачок, который надевается на вал диаметром 5/8 дюйма. Крышка грузовика 100XL. Toyota Tacoma SR5 2016 года выпуска. Леонард США — номер один. Обе модели имеют грузоподъемность более 1900 фунтов. Я всегда ношу вещи с ранчо в одной руке, а другой нажимаю кнопку задней двери, чтобы отпереть ее, в то время как брелок находится в моем кармане. Сверху вниз, от центра к центру, размер 5 1/4 дюйма. . 13! Корпус автоматического замка двери грузовика TODCO 69714-2 в сборе – лучший сердечник.Это гибкий, устойчивый к атмосферным воздействиям пластик, способный поглощать силу удара двери другого автомобиля о бок внедорожника, грузовика или легкового автомобиля. 192 долл. США. Пандусы TODCO, известные как todco rollaramps, доступны с помощью пружины в Магазине из тысяч деталей и аксессуаров, которые помогут вам восстановить, обслуживать и настроить свой грузовик или внедорожник Chevrolet, GMC, Dodge или Ford. Последним вариантом вакуумного резервуара Amthor является инновационный CLAW (подана заявка на патент), серия гидравлических рычагов для открытия и закрытия задней дверцы вакуумных резервуаров. 1994. Сохранить… Супер модератор. Снимите панель обшивки задней двери. Ф43-55345-013. Деталь №: 19518. Мы предлагаем запасные двери высшего качества (загрунтованные или предварительно окрашенные) по конкурентоспособной цене. Местонахождение: CarMax Renton в Сиэтле, штат Вашингтон, 98057. — Dodge. * Расчетные рейтинги пробега, указанные выше, являются приблизительными. Дверная защелка CHEVROLET, водоотражатель (резиновый) над защелкой. Добавить в корзину. Открутите один винт вверху и один внизу переднего нижнего фиксатора стекла задней двери. Что такое электрическая схема для Mazda B4000 Automatic 1999 года?Ваш запрос на запчасти будет немедленно отправлен по электронной почте в общенациональную сеть Junkyards. Сэкономьте 49 долларов. 27! 3-дюймовые барабаны для тросов дверей грузовиков. У меня есть bmw x5 2004 года, у которого 2 задние двери не открываются ни изнутри, ни снаружи после замены дверных ручек. Компания Southern Truck в Имлей-Сити, штат Мичиган, также выполняет качественный ремонт грузовиков и выполняет индивидуальные покрасочные работы. .Добавьте ценность и стиль интерьеру вашего автомобиля, заменив эти потрескавшиеся и выцветшие дверные панели легко и недорого.Ford Truck 1987-1996.Американская сила 22 за 7500 долларов.Мерседес. Под кузовом пикапа, кабиной и передней частью находится шасси или рама, а также ходовая часть (подвеска, оси, карданные валы и т. д.). Если так. 297 долларов. Доступны 3 варианта длины для высоты подъема до 16 дюймов. Я установил 4-дюймовые разделители на задние двери моей бывшей кабины. Эти бамперы рассчитаны на то, чтобы выдерживать удары с прочными слоями… Купить вентиляционное окно / дверное окно для вашего классического автомобиля 1980-х годов. 1996 Ford Truck на NPDLink.j Напишите нам об этом продукте.$23.8L V10.Аналогичные и рекомендуемые детали.и другие. 1-877-781-8140. 35 долларов. C/10 Обычная кабина CC10703 Кабина и шасси CC10704 Подножка CC10734 Бортовой парк: Короткая платформа 117. В Австралии и Новой Зеландии как пикапы, так и универсальные купе называются utes, сокращенно от внедорожника. Артикул:

938 Категории: CAB, КАЛЬМАР ОТТАВА. Запчасти для рулонных дверей Transglobal Roll-Up Doors Powerbrace Lockrod Assemblies Аппаратные средства Eberhard Lockrod Фурнитура Bloxwich Lockrod Дверные покрытия Вентиляционные отверстия и защелки задних дверей Поручни и держатели Дверные петли Детали дверей Superseal Дверные молдинги и прокладки Дверные косяки из ПВХ Дверные обшивки из ПВХ Дверные рамы и опоры сзади Дверные заготовки В 1953 году компания Whiting разработала первые практичные подъемно-поворотные ворота для грузовых автомобилей и прицепов.Большие, индивидуальные, хорошо освещенные датчики и кулисные переключатели. 4099768 40-48. 1973-87 Chevy & GMC Truck Черные алюминиевые пороги передних дверей Chevy Bowtie. ПРЕДУПРЕЖДЕНИЕ Этот продукт может подвергать вас воздействию химических веществ, включая бензол, который известен в штате Калифорния. Компания D & D Garage Doors обслуживает и ремонтирует двери грузовиков и прицепов по всему штату Флорида. Этот резьбовой стержень должен быть отрегулирован/возвращен в правильное положение, чтобы поднять дверную защелку. Ключевым измерением является расстояние между монтажными отверстиями.21 доллар. Это резиновый дефлектор дверной защелки, который находится над защелкой внутри двери. 1990. вес грузоподъемность. 00 iStock … Когда вы сидите в салоне автомобиля и смотрите внутрь дверцы люка, со стороны водителя механизма защелки вы увидите небольшой стержень с резьбой, который прикреплен к механизму защелки и защелке в нижней части дверь. Вы можете отключить детские замки, открыв каждую дверь и найдя узел защелки сбоку от дверного косяка. клиенты. 2 из 5 звезд 16 $218.Узнайте о стандартной системе BLIS® (Информационная система для слепых зон) и SYNC® 3 с 8-дюймовым центральным блоком. Доступен 5-литровый двигатель PowerBoost™ Full Hybrid V6. Есть мнения? 32-дюймовая боковая дверь автофургона с замком и барным замком (двери ручной сборки не провисают)-двойные задние двери-3/8-дюймовые фанерные стены-3/4-дюймовый фанерный пол-светодиодный плафон 12 В с парой переключателей бокового вентиляционного отверстия… RETRAC 409924 Высотные складывающиеся задние подножки для полуприцепов с автоматическим укладыванием, подходят для 4-дюймовой балки бампера, сталь, 600 фунтов, полуприцепы, закрытые грузовики 4. 80. Защелки и защелки для задней двери в наличии по низким ценам! У нас есть огромный выбор высококачественных запчастей для грузовиков средней грузоподъемности, включая тормоза, выхлопную систему, топливные баки, фары, детали для подъемных дверей и многое другое! Получите защелки и защелки для задней двери сегодня! Большинство заказов отправляются в тот же день! Подержанные двери грузовиков средней грузоподъемности и двери грузовых фургонов. Стекло изготавливается на заказ в США и поставляется напрямую от производителя. Настройте свой F-150 для лучшей в своем классе буксировки, грузоподъемности, мощности или крутящего момента. Выбирайте между стационарными или подвижными вариантами для обычных подъемных или распашных задних дверей.74. Запатентованный замок для подъемной двери 8050 также постоянно установлен и автоматически блокируется, когда дверь прицепа закрывается. 9 дюймов. Эта боковая или задняя дверная защелка легко устанавливается для обеспечения максимальной безопасности для всех прицепов, рефрижераторов, сухих фургонов и контейнеров. Видео показывает, как снять / установить панели задней двери самоубийцы Ford SuperCab, когда дверь застряла. KALMAR OTTAWA ДВЕРНАЯ ЗАЩЕЛКА, ЗАДНЯЯ

938 количество. 2009-2020 гг. Компоненты дверей 1947-55 Chevy & GMC Truck 1-й серии. 5. Классический шт. Двигатель.Первоначально стандартные для многих моделей, позже они стали популярными в торговле нестандартными автомобилями. На кузове и на двери монтируются основные уплотнители, препятствующие проникновению воды, воздуха, пыли и шума в автомобиль или транспортное средство. Графические наборы – Графические наборы для автомобилей и грузовиков Наклейки для автомобилей, графики на заднее стекло и наклейки на заднее стекло настраивают набор уплотнений для задней двери панельного грузовика; Возвращаться. 1988 Петля двери грузовика – Нержавеющая сталь – Петля задней двери 255x65mm BODY HEAVY DUTY. Откидные задние сиденья, обращенные вперед, позволяют разместить в этом грузовике четырех человек.RAM 1500 Copper Sport 2017 года поступит в продажу в этом году, только в кузове с двойной кабиной и только с двигателем HEMI V8 мощностью 395 лошадиных сил и 410 фунтами. Реставрация грузовиков, Изготовление на заказ и восстановление, Старинные грузовики, Сборщик грузовиков. Желательно бордовый. Пикап или пикап — это малотоннажный грузовик с закрытой кабиной и открытой грузовой площадкой с низкими бортами и задним бортом. Было: 99 австралийских долларов. Старые грузовики Chevy Джима Картера — ваш самый большой источник запчастей для грузовиков Chevy и GMC с 1934 по 1972 год.Размер кузова грузовика. Даллас, Форт-Уэрт, Ремонт двери грузовика-фургона. Мы понимаем срочную необходимость вернуть грузовики или трейлеры на дорогу, если дверь была повреждена или не работает должным образом. Регулируемый замок задней двери для грузовых прицепов и транспортных контейнеров. 12-дюймовые в длину от The Parkhurst Rear Doors развивались благодаря многолетнему опыту работы на зерновых полях. Местное семейное владение и управление, реинвестирование ваших денег обратно в Западную Вирджинию… Мы разбираемся в 9 элементах, которые отличают крышки грузовиков Leer от A.Я даже не могу сказать вам, сколько из них я заменил. $109.00 Каждый. Они несут Т-образные ручки, газовые упоры, купольные огни, стоп-сигналы и многое другое. Скорее всего, вы были позади одного из этих широкофюзеляжных автомобилей на дороге и заметили его мускулистую осанку и мускулистые крылья. Номер позиции: 34499B. com Стойка для шин и ящиков Описание продукта. 61. E. Добавить в список желаний. High Rise 22 – Увеличенная дверь с дополнительным зазором. Выберите год выпуска грузовика Toyota ИЛИ ВВЕДИТЕ СВОЙ VIN-код (идентификационный номер автомобиля) 1995.Кубатура: 669 куб. Наши подержанные двери для грузовиков включают: 94 левые и правые двери GMC C6500, подержанные двери GMC Savana 3500 со стороны водителя, GMC Savana. Корзина KALMAR OTTAWA КОМПЛЕКТ, КЛАПАН, РЕГУЛИРОВКА СЕДЛА

789 $ 192. Кузова фургона. 7 долларов. Распространенной модификацией Ford Transit является удаление запасного колеса из-под автомобиля, чтобы установить дополнительные баки для топлива или пресной воды. Инструкции о том, как правильно запирать и отпирать заднюю дверь на арендованных грузовиках U-Haul. Каналы шириной 57 футов и 75 дюймов. Он также подходит для корпусов других производителей.В кармане для мелочи. 65. 3000 долларов Задний кондиционер. Счет-фактура на 94 000 долларов (я не могу расстаться со своим ребенком… Уплотнитель двери грузовика – 21 серый ПВХ H. Южный грузовик в Имлей-Сити, штат Мичиган, продает без ржавчины GM, Chevy, Chevrolet, GMC, Ford, Dodge, Jeep, Toyota, Mazda, Isuzu, Запчасти для грузовиков Mitsubishi, Nissan и зарубежных производителей. 11 Марка кузова для грузовиков. Водоотражатель дверной защелки. РЫЧАГ СТЕКЛООЧИСТИТЕЛЯ KALMAR OTTAWA

940 51 $. представляет собой сверхмощный пикап с двумя задними колесами с каждой стороны, что обеспечивает больший контакт с дорогой и большую ширину для большей устойчивости, баланса и тяги во время движения.Нужны динамики на замену динамиков в задних дверях с хорошим басом. 1940-1946 Кронштейн задней фары Chevrolet Panel Truck Задняя дверь. Когда я открываю заднюю дверь после того, как грузовик постоял какое-то время, включается двигатель, который звучит так, как будто это электронная подножка. Распашные двери, с другой стороны, являются наиболее распространенным и стандартным типом, но оказываются бюджетной альтернативой. 33 доллара. Обе задние двери есть разве что, поскольку я не могу их открыть. 39. Запчасти для грузовиков Chevrolet 1957 года — кабина грузовика.Удалите звукоизоляционный материал внутри двери (фото №15). Оставьте 1-2 дюйма дополнительной области кровотечения, чтобы получить полное покрытие. 04 – 667 долларов. 1973-91 Компоненты передней двери. 1-888-903-0966. 192 доллара. Поразительный внешний вид капота, решетки радиатора и бампера, передняя часть… Задние окна грузовиков среднего размера, сравнимые с Chevy Avalanche, обычно имеют размеры 16 дюймов в высоту и 54 дюйма в ширину или 18 дюймов в высоту и 58 дюймов в ширину. Покупайте подержанные пикапы с бесплатными отчетами Carfax. Крюк специальной конструкции достает до заднего бампера и дверных порогов.НОВЫЙ! Камера заднего вида в дверях. -Высота проема задней двери 5 футов 11 дюймов – Ширина проема задней двери 6 футов – Боковая дверь RV 32 дюйма с замком и замком (двери ручной сборки не провисают) – Двойные задние двери – Стены из фанеры 3/8 дюйма – Фанера 3/4 дюйма напольный 12-вольтовый светодиодный плафон с парой выключателей бокового вентиляционного отверстия… Уплотнения задней двери пикапа Ford — панельный грузовик — левый и монтажный, ht. 25 пар. Создан из прочной полиэфирной ткани с покрытием. Кабина Nissan Titan Crew Cab 2020 года На более ранних моделях, таких как грузовики C/K с 1988 по 2002 год и S10, S15 и Sonoma с 1999 по 2003 год, она имела форму более длинной кабины с задними боковыми окнами, но без задних дверей.Кража трактора жива и процветает на стоянках для грузовиков и во многих других местах, где водитель должен остановиться, поэтому вам необходимо обеспечить 100% защиту вашего грузовика с помощью блокировки пневматического тормоза Tab 10. 1375 E Main St, Mount Joy, PA 17552; 717-653-5253 | 717-435-6414 | 631-887-6650; продажи@ishlers. Цена за единицу: 79 долларов. 5-дюймовый стоп-сигнал на задней двери. Быстрая установка. 1 дилер Leer в стране, что означает, что мы знаем их продукцию вдоль и поперек. Chevrolet Colorado LT 2018 года. Двойной 6-1/2″ для ручного стеклоподъемника Передняя дверь 00-06 GM FS Колонки для грузовиков $ 139.Марка Silverado 2500 и 3500 Truck Box 2017-2019 гг. Кроме того, мы также производим полную замену дверей. – ГМК. 1977-89 Полноразмерные алюминиевые накладки на пороги для грузовиков Chevy и GMC, передние и задние, кабина экипажа, комплект. ПЛАСТИНА В СБОРЕ, ЗАДНЯЯ ДВЕРЬ … Задние двери в двухместной кабине составляют примерно 3/4 длины передних дверей, а задние двери в многоместной кабине имеют почти такую ​​же длину, что и передние двери. TODCO производит двери из фанеры, двери из стекловолокна, алюминиевые двери, двери с алюминиевым покрытием и двери из поликомпозита для грузовиков, грузовых фургонов и грузовых прицепов.Ridgeline 2022 года имеет смелый вид спереди. Номер продукта: gm1253674239 $ 33. Номинальная нагрузка на сцепку: 10 000 фунтов Грузовики с двойной кабиной больше, чем грузовики с удлиненной кабиной, но меньше, чем грузовики с двойной кабиной. Кроме того, его текстурированная черная отделка придает дверному проему вашего грузовика привлекательный агрессивный шарм. Все грузовики Penske оснащены автоматической коробкой передач, кондиционером, антиблокировочной системой тормозов для более безопасной остановки, грузовыми стяжками, двусторонними зеркалами для лучшего обзора, гидроусилителем руля и задней подъемной дверью. Длина: 72 дюйма. Некоторые производители маркируют эту конфигурацию другим именем. Пассажировместимость 8. Kenworth T680 2022 года со 156-дюймовым спальным местом ARI Legacy, задней кроватью с боковой дверью (синий грузовик) 320-дюймовый WB Stock # 124272 ARI 2190. Очистите все стекла вашего автомобиля. 1. 00 53 – 56 Каталог запчастей для грузовиков Ford $ 0. – Ford. ЗАМОК В СБОРЕ, ПЕРЕДНЯЯ ДВЕРЬ, ПРАВ. Отделка относится как к внутренним, так и к внешним элементам, включая оконные уплотнители, дверные уплотнители, дверные панели и многое другое. Когда вы приедете к нам для замены заднего ветрового стекла, наши специалисты: Внимательно осмотрят повреждение.Накладка защищает навесной замок от попыток его взлома или распиливания. Пожизненная гарантия. 3. Там будет небольшой переключатель, и вы сможете сдвинуть его в другую сторону, чтобы отключить блокировку от детей. 00; 53 – … 2001 Chevy Lumina Car Door Rear from OREM, UTAH 84057″ Задняя дверь со стороны пассажира. 99 $21. Опустите стекло задней двери и снимите внутренние и внешние уплотнители стекла задней двери. Кол-во в корзине: 0 Итого: $0. Пока некоторые магазины могут считать нанесение надписей и наклеек на дверях грузовиков трудоемкими и сложными в разработке. Наши дизайнеры очень любят трансформировать автомобили и хотели бы работать с вами над созданием уникального единственного в своем роде дизайна.Бамперы Fusion со светодиодами за 4500 долларов. Если у автомобиля двойные задние двери, этот кронштейн крепится к левой двери. 44 доллара. com/Trucks/?utm_cam none Крышка/кожух кабеля задней двери Leer Truck Topper (изображение фактического предмета) (вид сбоку) Описание: Резиновый кожух для покрытия кабелей на стеклопластиковых бондажниках со стеклянными задними дверями. kooshball сказал: Итак, я думаю, что источником моего проникновения воды может быть уплотнение дверного замка на моих задних дверях. GM прекратил выпуск этой детали, и, похоже, ее не осталось. Добавлю то, что пока никто не озвучил.1-дюймовое колесо 2-дюймовый ролик двери грузовика. Пропылесосьте весь мусор и стекла автомобиля. 55; 53-56 Дверная петля Ford Truck — левая или правая $ 65. Если вам нужно заменить дверные петли Dodge или другую часть дверной петли, посетите нас онлайн или позвоните по телефону 888-844-3393 и закажите сегодня! Дверной протектор WeatherTech предназначен для защиты внутренних дверных панелей автомобиля от износа, разрывов и повреждений всех видов. Я говорю о кабине экипажа. Компания Whiting также является ведущим производителем ламинированных панелей на заказ. Задний стоп-сигнал • Базовые рельсы из стекловолокна • Опоры газовых дверей Связано: Lincoln Continental Coach Door Edition: Некоторые люди называют их дверями для самоубийц Технически, многие пикапы также предлагают эту функцию в виде распашных задних дверей на удлиненных кабинах.Портативный замок и защита CargoGard 8075W (Whiting) и 8075T (Todco) представляют собой высокопрочный стальной экран для защиты запорного механизма рукоятки защелки и навесного замка. Они помогают герметизировать вашу кабину от внешнего ветра и шума, а общенациональный локатор подержанных автомобильных запчастей отправляет запрос на запчасти на склады утилизации и получает несколько предложений. Обычно используется на старых стеклопластиковых и алюминиевых топперах. Ford Pickup Truck Наружная ручка двери – Хром – Задняя дверь -, Грузовик с панелью . 60 $ 118. AM HAIRE 26-ФУТОВЫЙ ДВИЖУЩИЙСЯ КУЗОВ.) Но даже если мы видим их все время, многое в грузовиках остается для нас чем-то вроде загадки за пределами этого мира, и одна из этих загадок привлекла мое внимание… Детали дверей. Нет никаких сомнений, самый простой способ определить ось и передаточное число в вашем грузовике — по наклейке на двери. Также называются стопорными стержнями. Доступные в различных размерах и с глянцево-красным порошковым покрытием на заводе, вы можете выбирать между двойными грузовыми дверями, тройными грузовыми дверями и воротами типа Beet Gate. Когда вам нужна замена дверных панелей и фурнитуры , приходите к нам за брендами, включая следующие: — Chevy.2022 Kenworth W900 с 156-дюймовым спальным местом ARI Legacy, задней кроватью с боковой дверью (красный грузовик), 346-дюймовым WB, дверями с ручным управлением. Лучшее в 2021 году: вот почему грузовые прицепы имеют стеганые задние двери: краткое пояснение (обновление: подробности от производителя) Это лучшее из… Высота проема задней двери: 6 футов 8 дюймов Ширина проема задней двери: 6 футов 6 дюймов Погрузочная рампа длина: 10 футов. Внутренняя ширина погрузочной рампы: 25 дюймов. Ширина погрузочной рампы: 27 дюймов. Длина от бампера до бампера: 21 фут 6 дюймов. Высота до земли: 11 футов.8 из 5 звезд. Особенности могут включать: Трубчатая конструкция основной рамы; Наружный диаметр 24 дюйма. CW5601. Дюрометр Серый, одинарная ножка 40 мм, длина 5 м. Комплект уплотнений задней двери со стороны водителя и пассажира (KD3015) от Fairchild®. Бесплатная доставка. алюминиевые крышки задних дверей для грузовиков Empangeni: +27 (0) 35 787 0212 Randall предлагает один из самых больших на сегодняшнем рынке вариантов штор для прицепов для задних и боковых дверей.В нижней части дверной обшивки есть небольшой утопленный отсек для хранения вещей, а после снятия отделки там будет отверстие, где находится отсек для хранения, который позволит получить доступ к нижней защелке. Толстая накладка ENFORCER® #8014 из нержавеющей стали надевается на дверную раму с двойными толстыми приваренными выступами для защиты навесного замка от несанкционированного снятия. Деталь №: F43-55345-013. Покупайте у нас большой выбор запчастей по бренду, цене, описанию и местоположению. 2021. мой плохой. Дверные уплотнители B7C-8120530/31 Нажмите ЗДЕСЬ, чтобы узнать ЦЕНУ.Наша команда специализируется на дверях коммерческих грузовиков и прицепов Whiting и Todco: запчасти, продажа, обслуживание и ремонт. Mid Rise 180 — на 20 % больше места, чем у грузовика с высокой кабиной. 11 218 долларов. Эти стильные панели были созданы, чтобы придать вашему интерьеру новый вид по более низкой цене, чем оригинальные панели. Я поставил 2 в грузовик с менее чем 200 Chevy Silverado, и в большинстве автомобилей есть детский замок на дверях пассажира или заднего сиденья, чтобы предотвратить его открытие изнутри. (То, что вы видите ниже, является предыдущим поиском задней двери пикапа GMC 2500, а не… Подержанные двери грузовиков средней грузоподъемности и двери грузового фургона. Они помещают тонкую ленту из металла/пластика на стойку задней двери: Каждая: 132285. Оценка сцепки: 10 000 фунтов Идентификатор изделия: 3933. Diamond Roll-Up Door является основным поставщиком сменных дверей. Защитите свои грузовики с помощью блокировки пневматического тормоза кабины грузовика War-Lok каждый раз, когда вы покидаете свой грузовик. Сегодня компания Whiting остается ведущим мировым разработчиком и поставщиком в отрасли полного ассортимента сухих грузовых, утепленных и специальных рулонных дверей, а также ламинированных распашных дверей. -Высота проема задней двери 5 футов 11 дюймов – Ширина проема задней двери 6 футов – Боковая дверь RV 32 дюйма с замком и замком (двери ручной сборки не провисают) – Двойные задние двери – Стены из фанеры 3/8 дюйма – Фанера 3/4 дюйма напольный 12-вольтовый светодиодный плафон с парой выключателей бокового вентиляционного отверстия… Продажа подержанных пикапов с 4-дверной удлиненной кабиной.Для Suburban 1999 года с задними распашными дверями вы можете просмотреть онлайн-каталог [также для многих других автомобилей GM] на сайте www. Предлагаются три модели, рассчитанные на всю жизнь, которые соответствуют вашим потребностям в перевозке зерна или сыпучих материалов. Найдите дверную панель Chevy, используя наш локатор запасных частей. Хромированный регулируемый замок ENFORCER® #1217 для прицепов и контейнеров защищает как активные, так и пассивные распашные двери от взлома. Единственный вариант с полной дверью на рынке обеспечивает легкий доступ к кузову вашего грузовика, а также лучшую видимость для пользователей, которые тянут прицепы любого типа.Держите их… Дверные панели Coverlay®. ПЛАСТИНА В СБОРЕ, ФИКСАТОР ЗАМКА ЗАДНЕЙ ДВЕРИ. Каждая панель изготовлена ​​из штампованной стали по оригинальным заводским спецификациям с правильными контурами по рекомендованной розничной цене 538 долларов США. Запчасти для грузовиков. 2. (Также доступен съемный штифт). ухал. 5-дюймовый проем, двойные распашные задние двери 50/50 или 70/30, полная ширина 50/50, FRP с замками с эксцентриком или засовом Распашные задние двери, двустворчатые двери во всю ширину, FRP с замками с эксцентриком Изолированный задний ролик -Up Door Enforcer Lock для подъемных дверных окон, задняя дверь 12 дюймов X 18 дюймов для кузова рефрижератора придаст вашему автомобилю привлекательный вид и в то же время сохранит их. Двери фургонов бывают разных типов в зависимости от типа и размера грузовиков. Рамка; 16-дюймовый O. Индивидуальный колпачок премиум-класса LEER, 100XL оснащен боковыми окнами в стиле внедорожника с выкручивающимися вентиляционными отверстиями и цельностеклянной задней дверью с поворотной ручкой LEER. СТИЛЬ. Изготовлен из прочного материала, запасная часть не будет трещины или трещины даже при экстремальных условиях. Подходит для оригинальной дверной панели. Изготовлен из высококачественных материалов. Рифленый дизайн шириной 75 дюймов и подходит для 1. Контактная правая рука на корпусе № 37-0929 без размораживания задней двери амбара: 18 долларов США.Подробнее. Вернуться домой Выберите «Новое транспортное средство». Если вам нужны двери б/у, то UneedAPart. 00 … Наши 6-дверные пикапы King Series под ключ обычно стоят от 89 000 до 95 000 долларов в зависимости от года выпуска, пробега грузовика, уровня отделки салона, одинарного или двойного заднего колеса, а также опций и обновлений покупателя. 30 998 долларов США • 83 тыс. миль. Думаю, я должен был спросить раньше. 61 $ 125. Проверьте свои измерения для вашего приложения перед заказом. Если вам нужно заменить дверную защелку Ford F-150 80-96 года в сборе, National Parts Depot поможет вам.Заказывайте деталь, имея на руках инвентарный номер. Шасси пикапа и ходовая часть. Palomino RV сообщает о стандартной сухой массе пикапа HS-2912. A Crew Cab имеет четыре двери, которые ведут к двум полным рядам сидений. Защелка двери грузовика Ford 1980–1996 гг. Разработанные так, чтобы исторически соответствовать эстетике вашего грузовика Ford 1980–1996 годов, эти защелки и защелки наружной двери от NPD являются деталями высшего качества. — Фольксваген. (То, что вы видите ниже, является предыдущим поиском задней двери пикапа GMC Sierra 1500 и не включает все задние двери в ВАШЕМ районе.66. Зернистая поверхность с высоким сцеплением для дополнительной безопасности и сцепления. Этот кожух используется в Leer 100 XL и 100 XQ. Когда вы сидите в салоне автомобиля и смотрите внутрь дверцы люка, со стороны водителя механизма защелки вы увидите небольшой стержень с резьбой, который прикреплен к механизму защелки и защелке в нижней части двери. Количество KALMAR OTTAWA ЗАДНЯЯ ДВЕРЬ, КРЕПЛЕНИЕ, СБОРКА CTT00008131. 78 160 долларов. Вы можете найти детали для крышек грузовиков и крышек багажника из стекловолокна в Truck Outfitters Plus.Двери TODCO, иногда называемые дверями todco, рулонными дверями todco или дверями для грузовиков todco, являются лучшими на рынке. Запчасти для рулонных дверей Transglobal Roll-Up Doors Powerbrace Lockrod Assemblies Аппаратные средства Eberhard Lockrod Фурнитура Bloxwich Lockrod Дверные покрытия Вентиляционные отверстия и защелки задних дверей Поручни и держатели Дверные петли Детали дверей Superseal Дверные молдинги и прокладки Дверные косяки из ПВХ Дверные обшивки из ПВХ Дверные рамы и опоры сзади Дверные заготовки 1937 1938 Dodge Pickup & Truck Крылья и двери: 1936 Chevrolet Coupe & Sedan: 1928 1929 Model A Дверные стойки автомобиля: 1938 Dodge 2dr Slant back седан (сборный) 1936 Chevy Pickup: 1928 1929 Model A пикап и грузовик: 1937 1938 Chevy Coupe & Sedan: 1928 г. Модель A 1929 г. Кабина пикапа: 1939 г. Dodge Coupe & Sedan: 1937 г. Chevy GMC пикап Durometer Grey & Black 44MM 3.Устаревшие и классические автозапчасти Южный грузовик в Имлей-Сити, штат Мичиган, продает без ржавчины OEM Ford, F150, F250, F350, Ranger, Bronco, Excursion, Explorer, Ecoline Truck Parts, включая нержавеющие крылья, нержавеющие двери, нержавеющие кровати и коробки и Кабины без ржавчины. 89 долларов США. of … Все категории > Петли для грузовиков/трейлеров > Петли задней двери : Петли задней двери: Нажмите на продукт, чтобы просмотреть подробности. Цена за единицу: 125 долларов. Грузовик был без подножек (но он был в употреблении). Их можно мыть вручную или на большинстве автоматических моек.50″ на 1. Может быть установлен заподлицо на дверях со смещением 3/4″. 1935-1937 Пикап Ford 3/4 тонны Полная передняя панель пола. 41 доллар США. Мы обеспечим вас от начала до конца! Не стесняйтесь обращаться к нам с вашими вопросами. Название стиля 2WD 1500 LS. Компоненты двери 1980-96 F150 F250 Bronco 1980-96 Crew Cab F250. Компоненты дверей 1957-60 F100 F250. Это запирающая внешняя ручка задней или боковой двери для грузовиков, которым нужна ручка с 1. Обычно это вызвано сломанным корпусом троса, предотвращающим Ram Year.У меня Cheyenne RST 2019 года, по какой-то странной причине Chevrolet удалил кнопки задних дверей в 2020 и 2021 годах, в то время как GMC не сделал этого на своей Sierra. Стиль крышки грузовика High C дополняет линии современных грузовиков, обеспечивая при этом большую внутреннюю высоту. , и увеличенный проем задней двери. ОТБЕЛИВАНИЕ ДВЕРНЫХ ЧАСТЕЙ ГРУЗОВИКАПросмотреть все . Многие клиенты, отправляющие/принимающие продукты питания, предъявляют строгие требования к герметизации дверей трейлера во время транспортировки. Теперь я предполагаю, что ваш грузовик представляет собой удлиненную кабину. Вы видели крышки Lakeland Truck Caps и Tonneau Covers на кузовах тысяч довольных владельцев грузовиков.Кражи средь бела дня происходят регулярно, когда подъемная дверь остается без присмотра или сломана и не открывается. Комплект уплотнений задней двери панельного грузовика. О. №2 · 19 июня 2015 г. Комбинированный рак/врожденный порок. T. Объем груза (максимальный объем груза: 49. Поскольку задняя дверь кузова рефрижератора довольно износостойкая, она станет верным другом вашего автомобиля. на заднем сиденье Будьте предельно осторожны при использовании моек высокого давления.Дверь со стороны пассажира имеет небольшую вмятину под окном/Позвоните по следующему номеру для детали. 57 австралийских долларов. 33. Артикул 565-440. Номер позиции: 34351CC. Поставляется с несъемным штифтом для максимальной безопасности. Заменяет OEM № 7C-43722/3-82. Когда задние двери грузовиков с закрытым кузовом находятся в аварийном состоянии, ваш груз уязвим, и в конечном итоге он может стоить намного больше, чем регулярно обслуживаемая и ремонтируемая рулонная дверь. Дверной уплотнитель » Бамперы » Запчасти для грузовиков Chevy 1953 года Дверной бампер – Suburban с дверями в виде раскладушки (3711168 47-55) Бампер дверного косяка, задний (4 шт. 54) EL-2 Teardrop Бескаркасная защелка задней двери – Используется на более новые крышки грузовиков Ranch, Century, Jason и Raider ** Можно использовать с модулями доступа без ключа (требуется отдельный жгут) Шаг 1 – Получите доступ.RES32J Уплотнитель двери контейнера. Оборудование включает пружинные болты, ручки, петли, защелки, стержни, замки, веревочные кольца, стальные стержни, кулачки, проушины, фиксаторы, прокладки и газовые пружины. Выберите скамью, сиденья Max Recline и опциональную внутреннюю рабочую поверхность. Внутренний уплотнитель окна прикреплен к верхней части панели. ПРОДАЖА ОБОРУДОВАНИЯ ДЛЯ ГОРОДА НА ПОБЕРЕЖЬЕ … Теперь вы сможете увидеть металлическую панель задней двери под ней. 11 – 5 футов 11 дюймов, высота проема задней двери – 6 футов, ширина проема задней двери – 32 дюйма, задняя боковая дверь с замком и замком (двери ручной сборки не провисают) – двойные задние двери – 3/8 дюйма, фанерные стены – 3/4 дюйма. фанерный пол-12-вольтовый светодиодный плафон с парой выключателей бокового вентиляционного отверстия… Легкий доступ к кузову вашего грузовика. Дверь самоубийцы — это автомобильная дверь, которая крепится сзади, а не спереди. … Дверные кнопки, все грузовики серии M, зажимы для дверных панелей, упаковка из 18 кнопок для всех задних полок, упаковка из 4 штук, загрунтованы, готовы к покраске 1937 Studebaker Coupe Express – 1938-1939 Studebaker Coupe Express – 1937-1940 Studebaker Truck 8 ″ с Несколько вариантов задней двери 00-06 Полноразмерные дверные динамики GM FS Truck 6 1/2″ Удлиненные задние дверные модули кабины 00-06 Silverado Sierra $ 124. Двигатель Газ/этанол V8, 5. Это один из самых больших вариантов в класса и открывает максимальный грузовой рейтинг 49.95 сэкономить 22%. Наш стандартный пакет преобразования включает в себя МНОГО! И то, что вы делаете индивидуальную сборку, не означает, что она стоит дороже. расширенная кабина = 2 полноразмерные двери сзади… 1992 Toyota Truck Regular Cab. Вот 10 простых способов починить защелку задней двери на Ford F150. Каждый продаваемый грузовик с закрытым кузовом оптимально обслуживается, чтобы обеспечить вам самую безопасную и плавную езду. 99. У меня не открываются замки задних дверей, передние работают нормально с пульта и внутренней панели управления. 95 набор. Контакт-правая рука на корпусе № 37-0927 с размораживанием задней двери сарая: 44 доллара.Наши шторы для прицепов помогают создать барьер между прохладным воздухом внутри прицепа и теплым влажным наружным воздухом. 9 кубических футов, что является самым высоким показателем в классе. 3-дюймовые размеры также отстают от моделей Chevrolet и Sierra, когда речь идет о пространстве для ног. 36 долларов. Позволяет открывать на 270 градусов. Дверное уплотнение Ответ (1 из 14): Пожалуйста, прочтите другие ответы о вентиляции и контроле температуры при транспортировке продуктов. Дверные шторы Randall Strip, которые легко пройти, легко установить и легко обслуживать, изготавливаются на заказ в соответствии с внутренними размерами каждого трейлера.Все началось с того, что дверь не закрывалась / не открывалась с помощью пульта дистанционного управления (приходилось запирать и открывать ее вручную), а затем однажды она не открывалась и не открывалась. Защелка двери грузовика Ford F-серии 1987-1997 годов. Задняя дверь. , Правильно. 1957-66 Дверные уплотнители крепятся к двери. И найдите другие изображения в библиотеке роялти-фри стоковых изображений iStock, содержащих фотографии грузовиков, которые можно быстро и легко загрузить. Когда вы сравните наше качество, посадку и наши сбережения, вы сами убедитесь в этом. RES25H 25 ‘H’ Уплотнитель двери грузового автомобиля – черная двойная ножка из резины EPDM.Они также защищают трейлер от пыли, насекомых и мусора. ·. Кол-во: Добавить в корзину. Polar Hardware Mfg Co. является производителем фурнитуры для дверей и кузовов грузовиков на заказ для промышленного применения. Они дают место для крепления оригинального прямоугольного заднего фонаря. com это сайт для вас! Мы можем помочь вам найти подержанные двери для легковых автомобилей, грузовиков, фургонов и внедорожников. Менее чем через 3000 миль возникли серьезные проблемы с механизмами блокировки, из-за которых задние двери стали бесполезными. 60! TODCO Truck Door 69714-1 Корпус автоматического замка в сборе.Выберите между бронзовыми или черными 18-дюймовыми легкосплавными дисками, чтобы усилить визуальную привлекательность вашего Ridgeline. 101 доллар. 57-79 Грузовик, 61-67 Эконолайн – Дверь. Рестайлинг передней части. О подержанных частях для грузовиков Rasco: Проверьте нас на :Facebook: – :Ebay Store:. – Джип. Кабина High XL — крышка кузова грузовика с окнами в стиле внедорожника. Сэкономьте 23 доллара. Регулируемый имеет литой стальной блок, который защищает навесной замок ABLOY® 350 (входит в комплект) для максимальной безопасности от подержанных пикапов с 4-дверной кабиной для продажи. 7. ком! Бесплатная доставка на сумму более 300 долларов США, быстрая доставка и низкие цены каждый день! НАЩЕЛЬНИКИ, СТЕКЛО ЗАДНЕЙ ДВЕРИ.Двигатель: 6. Восстановленный ПТС. 95. ком | части @ishlers. Стойка для задних фонарей Panel и Suburban. CC10906 [с задними дверями] CC10916 [с задней дверью задка] C/10 129. С 1996 по 2002 год одна задняя дверь со стороны пассажира была доступна в качестве опции для C/K. Поместить их на свой грузовик очень просто благодаря конструкции с кожурой и палкой. От 5195 долларов. Дверная защелка с кулачковым замком идеально подходит для боковых или задних дверей небольших прицепов, фургонов и грузовиков. Засов мостового типа помогает предотвратить случайное открывание и обеспечивает безопасное запирание. УПЛОТНЕНИЕ ДВЕРИ — СТОРОНА ВОДИТЕЛЯ (’98-’02, QUAD CAB) Артикул: DWL-3120-98.Грузовики Penske являются одними из новейших парков в отрасли. 1978–91 Chevy Blazer и GMC Jimmy Алюминиевые накладки на пороги, пара. Уникальное расположение вентиляционного отверстия под приборной панелью сохраняет ноги и ноги в тепле зимой и в прохладе летом. В 1953 году компания Whiting разработала первые практичные подъемно-поворотные ворота для грузовых автомобилей и прицепов. Они лучше всего используются компаниями, которые занимаются небольшими быстрыми поставками… В Truck-N-Trailer Service and Repair есть команда высококвалифицированных и опытных специалистов, готовых предоставить у вас есть конкретное решение для каждой из ваших потребностей в ремонте задней двери грузовика с закрытым кузовом. Мы можем предоставить вам дверь на замену примерно через 5 рабочих дней или предоставить универсальные двери в наличии для … Дверь грузовика TODCO 69634 Замок в сборе — только замок. 71. 50 $ 25. Загрузите свое снаряжение, как хотите. Кроме того, F-250 XLT имеет стандартную систему помощи при столкновении. Резиновые уплотнители дверей, направляющие дверного стекла, детали уплотнителей и устаревшие детали для классических грузовиков Chevy и грузовиков GMC от Classic Parts of America. На ступень выше, LEER 100XL с его утопленными окнами в стиле внедорожника с выкручивающимися вентиляционными отверстиями и экранами надежно защищает ценный груз, улучшая аэродинамику вашего грузовика и обеспечивая стильный, законченный вид.13 – 603 доллара США. 00; 53-60 Болт шарнира двери грузовика Ford — фланцевый болт OE $ ​​0. Чтобы найти заднюю дверь пикапа GMC Sierra 1500 в ближайшем к вам переработчике, просто введите ГОД своего автомобиля и свой почтовый индекс в форму выше и нажмите «НАЙТИ». ” кнопка. Класс EPA Нет данных. Запорные штанги – это стержни, которые предназначены для установки на задние двери грузовика, которые имеют одну ручку и систему управления стержнями. В наличии. Например, Toyota называет подобные грузовики пикапами Double Cab и использует название CrewMax для описания одной из моделей полноразмерной линейки Tundra.№ F-25860-1A. Кабина пограничного экипажа. Вариант двери Walk-In уникален для A. Внешняя дверная ручка, пластиковая, черная, Chevy, GMC, задняя сторона со стороны водителя, каждая деталь. КУЗОВ С ЗАДНИМИ ПОВОРОТНЫМИ ДВЕРЯМИ, 1 ДВОЙНАЯ ДВЕРЬ СО СТОРОНЫ ВОДИТЕЛЯ, 2 ДВОЙНЫЕ ДВЕРИ БОРТ. Рыночная цена: $89. Номер детали: SHI-901-137L Белое универсальное автомобильное зеркало заднего вида с углом поворота на 360 градусов с антибликовым покрытием HD-изображение Широкое плоское автомобильное внутреннее зеркало заднего вида для грузовиков Подарки 29 4.… 1A Auto предлагает полную линейку запасных частей дверных петель для вашего Dodge по отличным ценам. Дверной уплотнитель серого цвета с одной ногой длиной 5 м Этот продукт представляет собой дверной уплотнитель серого цвета с жестким корпусом из ПВХ, который часто используется, когда требуется уплотнение между двумя краями дверей на грузовых автомобилях, грузовиках, автобусах и конных повозках. Мы можем заменить гусеницы, ролики, тросы, панели, запорную фурнитуру, пружины, приводы как на рулонных, так и на распашных дверях. Для всех автомобилей и грузовиков. Повторно используйте свои оригинальные подлокотники или закажите новые для использования с этими панелями.Задняя дверь с одним Т-образным замком для тяжелых условий эксплуатации. Полная масса автомобиля: 14 050 фунтов. Ручка LEER Flip-Lock с откидным защитным кожухом; 50/50 Раздвижные боковые окна с экранами Репродукция оригинальной дверной коробки для моделей Chevrolet и GMC Pickup, Suburban и Panel Truck 1955-59 годов. Задние двери распахиваются вперед, как и передние. Высота проема задней двери: 6 футов 8 дюймов Ширина проема задней двери: 6 футов 6 дюймов Длина погрузочной рампы: 10 футов Внутренняя ширина погрузочной рампы: 25 дюймов Ширина погрузочной рампы: 27 дюймов Длина от бампера до бампера: 21 фут 6 дюймов Высота до земли : 11-футовая задняя подъемная дверь; вместимость.Выберите лучшую дверь для доставки. Крышки для грузовиков и аксессуары для грузовиков производитель крышек из стекловолокна для пикапов, навесов для грузовиков, крышек, крышек, крышек для грузовиков, корпусов кемперов, навесов, жестких крышек для грузовых автомобилей, рабочих крышек и аксессуаров для грузовиков. Это не так! -Высота проема задней двери 5 футов 11 дюймов – Ширина проема задней двери 6 футов – Боковая дверь RV 32 дюйма с замком и замком (двери ручной сборки не провисают) – Двойные задние двери – Стены из фанеры 3/8 дюйма – Фанера 3/4 дюйма светодиодный плафон на 12 В с парой выключателей боковых вентиляционных отверстий… • Задняя дверь в стиле внедорожника с системой закрывания с защелкой • Радиусное переднее окно • D.Представляем НОВЫЕ багажники для шин и ящиков для задних дверей Aluminess для Ford Transit. × Резиновые детали также см. в разделе «Окно и ветровое стекло». 800 фунтов. Международный. Стоп-сигнал с креплением на заднюю дверь подходит для нескольких марок корпусов кемперов, таких как Leer, Century, Raider, A. (ограниченное производство). 5″ вал. Truck Cap Rear Door Locking Bar. Door Lock and Latch – Dennis Carpenter Ident Your Ford Truck Axle From The Door Sticker. 1991. iStock Empty Moving Truck With Rear Doors Openedith Rear Doors Opened — стоковые фотографии и другие картинки 2015 Движущийся грузовик с открытыми задними дверями фото сейчас.Наш сервис «Локатор» поможет вам получить качественное дверное полотно. Качественная работа и соотношение цены и качества — это то, что мы предлагаем, специализируясь на регулировке, техническом обслуживании и ремонте задней двери вашего грузовика с закрытым кузовом, а его кабина Crew Cab с большими задними дверями и вместимостью для пяти человек лучше. Текущая дверь в качестве стеклоподъемника, но не требуется для замены. С формованными уголками. Наружная дверная ручка Dorman® HELP!™. 38. РУЧКА В СБОРЕ ЗАДНЕЙ ДВЕРИ ВНУТРИ, ПРАВ. Трансмиссия Задний привод. Автофургоны обычно используются для повседневной перевозки бытовой техники, мебели, ящиков и строительных материалов из разных стран.Бесплатная доставка по США для заказов на сумму более 250 долларов США*. … Бесфланцевый 6-1 / 2 ″ с несколькими вариантами для задней двери 00-06 GM FS Truck Speaker Pods Подробнее »Замените эту скучную решетку в задней двери вашего Tahoe, Suburban, Escalade, Yukon, Avalanche и Silverado / Sierra Crew Cab . Запросите или найдите все виды подержанных дверей, дверей подержанных автомобилей, дверей подержанных грузовиков, купите подержанные двери и онлайн-ресурс подержанных дверей! Наша общенациональная сеть автосвалок, переработчиков автомобилей, Auto Transform Your Truck. Classic Industries предлагает широкий выбор панелей кузова для вашего грузовика Chevrolet 1957 года выпуска.Узнайте больше о грузовиках U-Haul https://www. Сэкономьте 1 доллар. У нас на складе 436 деталей, готовых к отправке. Наша группа запчастей для грузовиков Dodge NOS (новые старые запасы) насчитывает 60 наименований, включая стеклоподъемники, дверные защелки, задние борта, крылья и жгуты проводов. Сделанные в США, эти 2 предмета не тускнеют, не выцветают и не ржавеют, обеспечивая потрясающий внешний вид на долгие годы. 00$ 59. Быстрый просмотр. 6 1/2 были бы кошмаром в удлиненной кабине. В этой паре накладок на пороги задней двери используется высокопрочный материал TUF-LINER.Количество. Д. 65 $6. Classic Industries предлагает компоненты кабины грузовика Chevrolet Truck 1957 года, кабину с порогом Chevrolet Truck 1957 года – в сборе, панели кабины грузовика Chevrolet 1957 года – частичные, заднюю внешнюю панель кабины грузовика Chevrolet 1957 года, углы кабины грузовика Chevrolet 1957 года, 1957 … крышки грузовиков Lakeland, крышки тонно и грузовик Аксессуары можно приобрести в наших розничных магазинах в Гринбуше, Висконсин — Мэдисон, Висконсин — Грин-Бей, Висконсин и Оук-Крик, Висконсин. v. Гарантия. Это зеркало заднего вида марки Fatties имеет полированный овал размером 4-1 / 2 дюйма x 1-3 / 4 дюйма … 1935-1937 Ford 3/4 Ton Pickup Truck Complete Front Floor Pan.”Приборная панель Chevy Silverado 2500 2005 года от TUCSON, ARIZONA 85716″ Я хочу изменить цвет салона с коричневого на черный, поэтому я остановился на дверных панелях приборной панели и перчаточном ящике. “Бамперы погрузочной площадки для тяжелых условий эксплуатации поглощают удары и предотвращают повреждения от Стыковочное оборудование и оборудование для грузовиков SPRINTER 2500. Фото 16. 98 $248. Если ваш грузовик 2007 модельного года, прежде чем сделать выбор, проверьте, является ли он классической моделью. Не держите мойку высокого давления на расстоянии менее 12 дюймов от вашего заднее стекло Примечание: На рисунке показан только один винт.1989. 68 19 долларов. 9 куб. футов): стандартная коробка Chevy Colorado имеет размеры 6 футов 2 дюйма. Зеркало заднего вида, Fatties Super – овальная головка 4-1/2″ X 1-3/4”, полированное. 2009 – 2014 Ford F150 – 2010 F150 Задняя дверь не разблокируется, не открывается – Привет, у меня F150 Supercrew 2010 года, и задняя дверь со стороны водителя не разблокируется и не открывается. Это обеспечивает коридорный стиль организации груза для легкого доступа ко всем грузам во время загрузки. Комбинированный рак/врожденный дефект ПРЕДУПРЕЖДЕНИЕ Этот продукт может подвергать вас воздействию химических веществ, включая никель, который, как известно в штате Калифорния, вызывает рак при врожденных дефектах или другой вред репродуктивной системе.RES32HEPDM 32 ‘H’ Уплотнитель двери грузовика – черный каучук EPDM, двойной л. 1948-1952 гг. Уплотнители задних дверей грузовиков Ford заменяют высохшие и потрескавшиеся оригинальные уплотнители для восстановления защиты от непогоды. Сначала правая задняя дверь не реагировала на дистанционный ключ или переключатель отпирания замка внутри. 359 долларов. 66-7/16-дюймовая запорная планка с засовом для дверей грузовика | Starcraft LB66. 4784 стойки. Одна, в которой устранена проблема с соответствующей сборкой. Для еще большей доступности можно настроить дополнительную боковую дверь и эксцентриковый стержень.Пандусы TODCO, известные как todco rollaramps, доступны с пружинным усилителем для TODCO, производящего фанерные двери, двери из стекловолокна, алюминиевые двери, двери с алюминиевым покрытием и двери из поликомпозита для грузовиков, грузовых фургонов и грузовых прицепов. Его задача — полностью закрыть ручки стояночного тормоза и воздушного клапана. Всего несколько месяцев назад я с радостью заплатил более 50 000 долларов НАЛИЧНЫМИ за 4-дверный грузовик FORD F-150. Подъемные задние двери чаще используются в автомобилях с ограниченным пространством. Этот шаг в значительной степени зависит от года выпуска грузовика, а также от уровня отделки салона, поскольку точки соединения между ними различаются.Если вы откроете дверь водителя и посмотрите на дверной косяк, вы увидите наклейку, подобную той, что показана ниже: вы увидите, что область, отмеченная (F), предназначена для кода оси. Morgan Truck Body уже 70 лет является ведущим производителем кузовов для грузовиков и фургонов в Северной Америке. Покрывало, 4WD/AWD, спутниковое радио, камера заднего вида, легкосплавные диски, дополнительный аудиовход. Это прямая замена и оригинальная ручка для Supreme Spartan Body. В Южной Африке люди всех языковых групп используют термин бакки, уменьшительное от слова бак, на африкаансе для обозначения «чаши» или «контейнера».Mill Supply может поставить вам дверь в сборе или только запасные части. грузовик с задней дверью

границ | Связь полиморфизма BDNF Val66Met с составом тела, кардиометаболическими факторами риска и потреблением энергии у молодых людей с ожирением: результаты исследования HEARTY

Введение

Высокая распространенность детского ожирения во всем мире (Di Cesare et al., 2019) представляет собой серьезную проблему для общественного здравоохранения, учитывая высокое и растущее социальное, экономическое и медицинское бремя, связанное с этим хроническим заболеванием (Wellman and Friedberg, 2002), и что ожирение и связанные с ним риски для здоровья отслеживаются с детства во взрослую жизнь.Независимо от географического положения увеличение массы тела, ведущее к ожирению, является результатом сложной комбинации генетических и экологических факторов, которые в конечном итоге приводят к тому, что потребление энергии превышает расход энергии (Farooqi and O’Rahilly, 2007). Хотя считается, что около 5% тяжелого ожирения зависит от влияния одного гена (например, MC4R), оценки наследуемости составляют от 40 до 70% в зависимости от изучаемых популяций (Farooqi and O’Rahilly, 2007). Следовательно, ожирение является высоконаследственным и гетерогенным заболеванием.Индекс массы тела (ИМТ) используется в качестве критерия для измерения избыточной массы тела (ИМТ 25–29,2 кг/м 2 ) и ожирения (ИМТ ≥ 30 кг/м 2 ) у взрослых, а кривые роста основаны на тех же критериях. которые соответствуют ≥ 85-му процентилю ИМТ (избыточный вес) или ≥ 95-му процентилю ИМТ (ожирение) для возраста и пола, обычно использовались для детей и молодежи. Было идентифицировано несколько генов-кандидатов, положительно связанных с ИМТ и ожирением, включая ген, ассоциированный с жировой массой и ожирением (FTO) (Zhao et al., 2014), а совсем недавно — ген мозгового нейротрофического фактора (BDNF) (Zhao et al., 2009).

Нейротрофический фактор головного мозга представляет собой белок, который оказывает плейотропное действие на мозг и периферические ткани (Marosi and Mattson, 2014) и синтезируется из белка-предшественника (про-BDNF) (Carlino et al., 2011). BDNF является одним из наиболее экспрессируемых нейротрофинов в головном мозге, с первичным действием в гиппокампе, коре головного мозга, мозжечке, гипоталамусе и стволе головного мозга (Egan et al., 2003). Несмотря на то, что в первую очередь его роль в содействии пролиферации, дифференцировке и общему выживанию нейронов в ЦНС была признана (Egan et al., 2003), действие BDNF вызвало интерес в изучении центрального контроля потребления пищи из-за обильного экспрессия в областях мозга, участвующих в регуляции аппетита (Lebrun et al., 2006). BDNF также участвует в регуляции метаболических функций, таких как окисление жиров и использование глюкозы (Tsuchida et al., 2001; Yamanaka et al., 2007; Matthews et al., 2009), и было показано, что он подавляется у людей с ожирением и диабетом 2 типа (Krabbe et al., 2007; Zhao et al., 2009). На животных моделях показано, что делеция BDNF в мозге мышей приводит к ожирению, гиперфагии и нарушению двигательной активности (Kernie et al., 2000), а у людей потеря одной копии гена BDNF также связана с гиперфагией. тяжелое ожирение и нарушение когнитивных функций (Gray et al., 2006).

Обычный однонуклеотидный полиморфизм в гене BDNF человека (rs6265), вызывающий аминокислотную замену валина на метионин в остатке 66 (т.e., Val66Met) в последнее время вызывает повышенный интерес как функциональный полиморфизм гена BDNF. В частности, считается, что вариант Met отвечает за аномальную внутриклеточную упаковку предшественника BDNF (pro-BDNF), а также за снижение продукции/экспрессии зрелого BDNF (Egan et al., 2003). Таким образом, аллель Met был идентифицирован как гипофункциональный аллель BDNF, тогда как аллель Val связан с нормальной упаковкой и экспрессией BDNF. Так называемый гипофункциональный аллель Met был положительно связан с ИМТ в большой выборке взрослых людей (Shugart et al., 2009) и детей (Skledar et al., 2012; Martínez-Ezquerro et al., 2017), но в других исследованиях не было выявлено ассоциаций у взрослых (Friedel et al., 2005) и детей (Arija et al., 2010; Vidovic). и др., 2020). Более того, в других исследованиях были получены противоположные результаты, согласно которым аллель Met был связан с более низким ИМТ у здоровых взрослых (Sustar et al., 2016), подростков (Kalenda et al., 2018) и более низким голоданием (Vidovic et al., 2020). ) и уровни глюкозы после приема пищи (Kalenda et al., 2018). Точно так же есть некоторые доказательства, хотя и ограниченные, чтобы предположить, что минорный аллель Met связан с повышенным потреблением калорий у детей (Kalenda et al., 2018), но более убедительные доказательства того, что аллель Met связана с расстройствами пищевого поведения, такими как переедание (Gratacòs et al., 2007), согласуются с исследованиями на животных, показывающими, что подавление BDNF связано с гиперфагией (Kernie et al., 2000). Интересно, что, несмотря на пагубные эффекты аллеля Met, полиморфизм Val66Met высоко консервативен у людей и может давать селективные преимущества. Действительно, лиганд продомена Val66 (Val/Val) BDNF способствует длительной депрессии в гиппокампе (Zanin et al., 2017), что может иметь значение для нейрокогнитивных (Voineskos et al., 2011), нарушений аппетита и обмена веществ (Zanin et al., 2017).

Целью данного исследования было изучить, отличаются ли носители полиморфизма BDNF Val66Met Met-аллеля (аллели Val/Met-G/A или аллели Met/Met-A/A) от носителей гомозиготного Val/Val (G/ Ж) аллели антропометрических показателей, кардиометаболических факторов риска и энергетического потребления в выборке подростков, живущих с избыточной массой тела и ожирением. Было высказано предположение, что носители BDNF Met-аллеля будут демонстрировать большее ожирение, более высокое потребление энергии и более низкие кардиометаболические маркеры здоровья по сравнению с гомозиготными носителями Val-аллеля.

Материалы и методы

Участники

В настоящем исследовании используется перекрестный дизайн, представляющий собой вторичный анализ исходных данных исследования «Здоровое питание, аэробика и силовые тренировки в юности» (HEARTY), в котором изучалось влияние физических упражнений на процент жира в организме в качестве основного результата (Sigal et al. ., 2014), и другие показатели физического и психического здоровья у молодежи с избыточной массой тела и ожирением (Alberga et al., 2015; Goldfield et al., 2015; McNeil et al., 2017), включая качество жизни (Goldfield et al., 2017). Выборка, которая дала информированное согласие на генетический анализ и содержала интересующие данные, состояла из 187 участников из полной выборки из 304 (62% от полной исходной выборки HEARTY), но характеристики выборки между этой подвыборкой и полной выборкой HEARTY достоверно не различались (данные не показаны).

Критерии включения для участников исследования HEARTY включали: постпубертатный период (стадии Таннера IV–V), возраст 14–18 лет и ИМТ > 95-го процентиля для возраста/пола и/или ≥ 85-го процентиля для возраста/пола с как минимум один дополнительный фактор риска диабета или сердечно-сосудистых заболеваний (ССЗ), как описано в другом месте (Alberga et al., 2012). Критерии исключения включали участие в регулярных или структурированных физических упражнениях или спортивных мероприятиях более двух раз в неделю в течение более 20 минут в течение предыдущих 4 месяцев, сахарный диабет, использование каких-либо лекарств, улучшающих работоспособность, значительное изменение веса (увеличение или уменьшение ≥ 5% тела). вес) в течение 2 месяцев до включения в исследование, беременность в начале исследования, ограничения активности из-за болезни (нестабильная сердечная или легочная болезнь или выраженный артрит) и другие заболевания (например,g., расстройства пищевого поведения/клиническая депрессия), по мнению участника или врача-исследователя, делают участие в этом исследовании нецелесообразным.

Большая часть выборки (74%) были выходцами из Европы. 83% сообщили, что родились от родителей, окончивших какой-либо университет или колледж. Все участники дали информированное согласие и/или согласие. Родителей или опекунов попросили подписать форму согласия для всех участников в возрасте до 16 лет, в то время как участники в возрасте 16 лет и старше предоставили свое собственное информированное согласие.Это исследование получило одобрение Совета по этике исследований Детской больницы Восточного Онтарио (протокол № 05/04E) и Исследовательского института больницы Оттавы (протокол № 2004219-01H). Протоколы исследования соответствовали Хельсинкской декларации (Всемирная медицинская ассоциация, 2013 г.).

Дизайн и процедура

Для этого кросс-секционного исследования, проведенного в рамках исходной оценки исследования HEARTY, координатор исследования собрал полный медицинский анамнез, информацию о лекарствах и физической активности, а также медицинский осмотр.Клинические интервью также проводились для оценки критериев включения/исключения, а также истории болезни и развития, как описано в другом месте (Alberga et al., 2012). Социально-демографические характеристики, пубертатный статус, образ жизни и потребление энергии в условиях свободной жизни были дополнены самооценкой измерений в лаборатории, в то время как состав тела был количественно определен с использованием объективных измерений в лаборатории и МРТ (Alberga et al., 2012). Исследование проводилось с марта 2005 года по июнь 2011 года.

Измерения

Первичная независимая переменная

Полиморфизм BDNF Val66Met: аллели Val (G/G), Met (A/A) и Val/Met (G/A). ДНК экстрагировали из 12-часовых (ночных голоданий) образцов крови примерно 20 мл венозной крови, взятых утром из вены предплечья или локтевой вены, и хранили в морозильной камере при -80°С. Выделение геномной ДНК из образцов лейкоцитарной пленки проводили в соответствии с инструкциями производителя (набор FlexiGene DNA Kit (250), Qiagen, номер по каталогу: 51206, Германия).Концентрацию ДНК измеряли с помощью спектрофотометра (NanoDrop TM 2000, Thermo Scientific, Уолтем, Массачусетс, США). Реакции ПЦР проводили с использованием следующих праймеров (P1: CCTACAGTTCCACCAGGTGAGAAGAGTG, P2: TCATGG ACATGTTTGCAGCATCTAGGTA, P3: CTGGTCCTCATCCA ACAGCTCTTCTATAAC и P4: ATCATTGGCTGACACTTT CGAACCCA), а генотипирование BDNF проводили по методикам, описанным Sheikh et al. (2010). Четыре праймера амплифицируют два аллель-специфических ампликона (253 и 201 п.н.) и всю область в качестве внутреннего контроля.Реакцию ПЦР проводили в реакционном объеме 25 мкл, включая: 25 нг матрицы геномной ДНК, праймеры, 100 ммоль/л dNTP (Invitrogen, Калифорния, США), 3 ммоль/л MgSO4 (Invitrogen, Калифорния, США). США), 1X буфер для амплификации PCRx (Invitrogen, Калифорния, США), 1X раствор усилителя PCRx (Invitrogen, Калифорния, США) и 1 ЕД Taq ДНК-полимеразы (Invitrogen, Калифорния, США). Условия циклирования ПЦР использовали начальную температуру денатурации 94 ° C в течение 5 минут, за которой следовали 30 циклов 94 ° C в течение 45 секунд, 62.5°C в течение 60 с и 72°C в течение 60 с и заключительный этап удлинения 5 мин при 72°C. Ампликоны ПЦР разделяли на 1,5% полиакриламидном геле, окрашивали гель-загрузочным буфером BlueJuice TM (Invitrogen, CA, США) и визуализировали в системе визуализации геля ChemiDoc TM (Bio-Rad Laboratories, Mississauga, ON, Канада). ).

Зависимые переменные

Состав кузова

Рост и вес измерялись ростомером и бревнами соответственно, участники были одеты в легкую одежду и босиком.ИМТ определяли путем деления веса в килограммах на рост в метрах в квадрате. Окружность талии измеряли на уровне посередине между самым нижним ребром и вершиной гребня подвздошной кости, как описано ранее (Alberga et al., 2012). Состав тела оценивали с помощью МРТ на аппарате 1,5 Тл (EchoSpeed, версия signal 11; GE Medical Systems). Участники лежали ничком для получения изображений поперечного сечения всего тела с использованием протоколов Ross et al. (1992). МРТ анализировали с использованием программного обеспечения Slice-OMatic TM , версия 4.3; (Tomovision, Magog, QC, Канада). Безжировая масса (FFM) определяется как общая масса мышечной ткани, включая все обезжиренные скелетные мышцы, органы, кишечник и кости, без жировой ткани, в то время как жировая масса (FM) представляет собой количество висцеральной и подкожной жировой ткани. Процент жира в организме рассчитывали путем деления количества FM на общую массу тела (т. е. FM + FFM) × 100.

Кардиометаболические факторы риска

Двенадцатичасовые (на ночь натощак) образцы крови объемом примерно 20 мл венозной крови брали утром из вены предплечья или локтевой вены и хранили в морозильной камере при температуре -80°C.Измерения профиля липидов включали триглицериды (ммоль/л), общий холестерин (ммоль/л) и липопротеины высокой плотности (ЛПВП-Х, ммоль/л), которые измеряли ферментативными методами на анализаторе Beckman-Coulter LX20 (Beckman аппаратуры, Бреа, Калифорния, США), а концентрации холестерина ЛПНП рассчитывали с использованием уравнения Фридевальда (Friedewald et al., 1972). Отношение общего холестерина/ЛПВП-Х было получено из измеренных значений. Высокочувствительный С-реактивный белок (C-RP) измеряли с использованием высокочувствительной методики иммуноанализа частиц в ближнем инфракрасном диапазоне (Beckman Coulter Unicel DxC600 Synchron Clinical System и реагенты Beckman Beckman Coulter Inc.). Артериальное давление (АД) измеряли вручную с помощью ртутного сфигмоманометра на левой руке после 4 мин отдыха в положении испытуемых, сидящих с опорой на спину. Было проведено три измерения АД с интервалом в 1 мин; для анализа использовалось среднее значение двух последних измерений АД.

Потребление энергии: журналы еды за 3 дня

Под наблюдением зарегистрированного врача-диетолога потребление энергии (EI) оценивалось с использованием 3-дневных журналов приема пищи, о которых сообщали сами пациенты. Что касается надежности этой меры, в недавней статье, посвященной величине ошибочных сообщений ЭИ, было установлено, что не было существенной разницы между медианами процента лиц, сообщающих неверные данные, при сравнении трех основных методов самооценки потребления пищи: 24 часа. отзыв, 3- и 7-дневные журналы питания и записи о взвешивании продуктов питания (недооценка EI составила 13.4, 12,2 и 18,0% соответственно; Послусна и др., 2009). Подростков просили заполнить трехдневные журналы питания в режиме реального времени, сразу после еды, в течение двух рабочих дней и одного выходного дня до визита к диетологу. Участникам было поручено записывать количество или вес всех потребленных продуктов и напитков, а также записывать методы приготовления пищи, торговые марки и ингредиенты продуктов, а также рецепты смешанных блюд, когда это возможно. Заполненные журналы питания обсуждались между участником и диетологом во время личного визита для уточнения деталей и количества продуктов питания.Участникам были даны рекомендации по измерению размеров порций с использованием пищевых моделей, снабженных раздаточным материалом, в котором подробно описывалось, как измерять порции продуктов. Если у участников не было доступа к мерным инструментам (чашкам, ложкам и т. д.), им рекомендовалось следовать Руководству по удобным порциям Канадской диабетической ассоциации, включенному в раздаточный материал. Журналы пищевых продуктов были проанализированы с помощью программного обеспечения для анализа состава пищи (The Food Processor SQL 2006, ESHA Research, Салем, штат Орегон, США) для определения общего потребления энергии (среднесуточное количество ккал) и отдельного потребления макронутриентов (в граммах) для углеводов, белков и жиров. для каждого участника.В большинстве случаев зарегистрированные дни были последовательными, включая один выходной день и два будних дня, хотя некоторые отчеты о рабочих днях включали непоследовательные дни. Потребление каждого класса питательных веществ было усреднено за 3 дня для анализа.

Описательные переменные

Демографические переменные и переменные развития

Исходная социально-демографическая информация была получена от всех участников, включая возраст, пол, этническую принадлежность и самый высокий уровень образования родителей, согласно самоотчету.Для оценки стадии полового созревания использовалась система определения стадии полового созревания Таннера, хотя все участники находились в постпубертатном возрасте.

Физическая активность

Продолжительность физической активности, о которой сообщали сами, была рассчитана на основе вопроса «В среднем, как долго вы ежедневно занимаетесь каким-либо видом физической активности?» при этом физическая активность является кумулятивной, а не последовательной. Было предложено шесть вариантов ответов: 1 ≤ 5 мин, 2 = 5–15 мин, 3 = 15–30 мин, 4 = 30–45 мин, 5 = 45–60 мин и 6 ≥ 60 мин.Продолжительность физической активности (минуты/день) использовалась в качестве ковариаты в анализе.

Традиционное поведение экрана

Традиционное поведение перед экраном оценивалось с помощью анкеты, в которой оценивалось, сколько времени в часах в день участники тратили на просмотр телевизора, на видеоигры в сидячем/неактивном режиме (за исключением компьютерных игр) и на использование компьютера в развлекательных целях (за исключением работы в школе и включая работу за компьютером). игры). Вопросы о времени использования экрана оценивали использование как в будние, так и в выходные дни.Три типа поведения перед экраном (т. е. просмотр телевизора, сидячие видеоигры и использование компьютера в развлекательных целях) были объединены, а затем усреднены по выходным и будням, чтобы получить показатель общей продолжительности экранного времени в день (т. е. время использования экрана в будние дни/5 + экранное время в выходные/2 = среднее общее экранное время/день). Было показано, что аналогичные методы самооценки экранного времени имеют приемлемую надежность и достоверность у подростков (Leatherdale and Harvey, 2015).

Статистический анализ

Все переменные исхода были проверены на предмет нормальности.Все переменные состава тела и кардиометаболические показатели имели положительную асимметрию, в то время как переменные потребления энергии были нормально распределены, за исключением потребления подслащенных напитков. Все распределения были успешно нормализованы либо логарифмическим преобразованием, либо преобразованием квадратного корня на основе ранее описанных критериев (Tabachnick and Fidell, 2007). Базовые характеристики выборки были рассчитаны и представлены в таблице 1 с использованием средних значений и стандартных отклонений для непрерывных данных, а также частот и процентов для категорийных данных.Поскольку частота гомозиготного генотипа Val66Met Met/Met (A/A) низка (1–8%) в популяциях преимущественно европейского происхождения (Shen et al., 2018), мы объединили эту группу ( n = 6). ) с носителями аллелей Val/Met (G/A). Этих носителей Met-аллелей ( n = 88) сравнивали с носителями гомозиготного генотипа Val/Val (G/G, n = 99) по интересующим переменным с использованием независимых t -тестов для непрерывных данных. или критерий хи-квадрат для категорийных данных.Поскольку не было групповых различий по демографическим, антропометрическим или поведенческим переменным, групповые различия по интересующим исходам (состав тела, потребление энергии и кардиометаболический профиль) оценивались с помощью одномерной статистики (независимые t -тесты) по преобразованным переменным. Это было сделано для сохранения статистической мощности, а не для статистического контроля этих переменных с использованием многомерного моделирования, что без необходимости уменьшило бы мощность. Важно отметить, что непреобразованные данные были представлены в таблицах, чтобы облегчить интерпретацию поведенческих, физиологических и клинических исходов, но представленные значения p были основаны на анализе с преобразованными данными.Установив мощность на уровне 0,80 и предполагая, что двусторонняя альфа равна 0,05, мы могли бы обнаружить значительную групповую разницу, отражающую размер эффекта от малого до среднего ( Коэна d = 0,40) в интересующих исходах с использованием независимых t -тестов с выборкой. 97 участников в группе; таким образом, полученная нами выборка обеспечивала достаточную, хотя и незначительную мощность для оценки наших целей (Cohen, 1977). Распределение генотипов текущей выборки находилось в пределах равновесия Харди-Вайнберга на основе критерия хи-квадрат ( p = 0.65) по сравнению с популяцией молодежи европейского происхождения с ожирением (Skledar et al., 2012). Статистическая значимость определялась как двусторонняя альфа <0,05. Анализы проводились с помощью SPSS, версия 24.

Таблица 1. Характеристики выборки по генотипу BDNF Val66Met.

Результаты

В таблице 1 показана разбивка по частоте аллелей полиморфизма Val66Met для выборки. Только шесть участников были носителями гомозиготного (A/A) аллеля Met, при этом примерно равные пропорции участников были носителями гомозиготных вариантов Val (G/G) или Val/Met (G/A).Значимых групповых различий по возрасту, полу, образованию родителей, этнической принадлежности, стадии полового созревания, ожирению, физической активности или времени, проводимому за экраном, не было. Выборке в среднем было 15,5 лет, они жили с ожирением, в основном белые и происходили из хорошо образованных родителей / семей. Примерно 67% выборки составляли женщины. В среднем выборка подростков не была физически активной и проводила за экраном 5,6 часов в день.

Таблица 2 показывает, что по сравнению с носителями аллелей Val66Met, гомозиготных по Val (G/G), носители аллелей Met (G/A или A/A) сообщают о значительно более высоком уровне С-реактивного белка [ t (1,185) = 1 .96, p = 0,05], потребление энергии в виде белков [ t (1,184) = 2,46, p = 0,01] и жиров, [ t (1,184) = 1,96, p 0 = 0,01 ] и тенденция к более высокому общему потреблению энергии [ t (1,184) = 1,81, p = 0,07], безжировой массы [ t (1,181) = 1,82, p = 0,07] и ниже ХС-ЛПВП [ т (1,183) = 1,82, р = 0,07]. Других генотипических различий по показателям состава тела, кардиометаболическим факторам риска или потреблению энергии обнаружено не было.

Таблица 2. Состав тела, кардиометаболический риск и потребление энергии носителями гена BDNF.

Обсуждение

В текущем исследовании сравнивали, различаются ли подростки с ожирением, несущие различные варианты полиморфизма BDNF Val66Met, по составу тела, потреблению энергии и кардиометаболическому профилю. Мы обнаружили, что носители одной или двух копий аллелей Met (варианты G/A или A/A) демонстрируют более высокое потребление энергии в виде белков и жиров и более высокое содержание С-реактивного белка по сравнению с носителями гомозиготных аллелей Val.

Хотя все участники нашего исследования жили с избыточным весом или ожирением, наши выводы о том, что полиморфизм BDNF не может дифференцировать носителей вариантов Val и Met по ИМТ, согласуются с исследованиями, в которых участвовали молодые люди с ожирением и без ожирения из Испании (Arija et al. , 2010), Мексике (León-Mimila et al., 2013) и Сербии (Vidovic et al., 2020). Точно так же Friedel et al. (2005) сообщили, что не наблюдалось различий в частоте аллелей BDNF у немецких детей и молодежи с тяжелым ожирением, у школьников с недостаточным весом и у контрольной группы с нормальным весом.Тем не менее, другие исследования показали, что носители гипофункционального аллеля Met полиморфизма Val66Met демонстрируют большую степень ожирения на основе процентилей ИМТ или z-показателей ИМТ к возрасту в популяционных когортах молодежи европейского происхождения (Zhao et al., 2009). Китайская молодежь (Wu et al., 2010), хорватская молодежь (Skledar et al., 2012) и мексиканская молодежь (Martínez-Ezquerro et al., 2017), однако было обнаружено, что носители Met имеют более низкий стандартизированный ИМТ в другой популяции. на основе образцов европейской молодежи (Kalenda et al., 2018). Точно так же Sustar et al. (2016) обнаружили, что здоровые взрослые носители аллеля Met/Met имели более низкий ИМТ, но не было обнаружено связи между генотипами BDNF Val66Met и статусом массы тела у взрослых с ишемической болезнью сердца, что указывает на роль, которую аллель Met/Met играет в развитии ожирения. может различаться в зависимости от населения. В отличие от предыдущих исследований, которые полагались исключительно на ИМТ, наше исследование является первым, в котором исследуется связь между полиморфизмом BDNF и составом тела с использованием МРТ, что обеспечивает более высокий уровень точности количественного определения жировой и безжировой массы, что считается более надежным. предиктор осложнений, связанных с ожирением, чем показатели, основанные на ИМТ (Mitra et al., 2017). Интересно, что мы обнаружили, что, несмотря на отсутствие различий в массе тела, ИМТ или жировой массе, носители Met-аллелей полиморфизма Val66Met демонстрировали тенденцию к большей безжировой массе по сравнению с гомозиготными носителями Val (G/G). в то время как другое исследование в педиатрии показало более низкое центральное ожирение, измеренное по окружности талии, среди носителей аллеля Met (Xi et al., 2013). Будущие исследования должны подтвердить эти первоначальные результаты, чтобы определить не только ассоциации между генотипом BDNF и фенотипом ожирения, измеренным с помощью ИМТ, но и определить, существуют ли значимые различия в строгих показателях состава тела между носителями разных аллелей Val66Met и как эти различия могут быть связаны с метаболическими и связанными с питанием последствиями.

Было показано, что нейротрофический фактор головного мозга играет неотъемлемую роль в регуляции аппетита как у людей (Gray et al., 2006; Marosi and Mattson, 2014), так и у животных (Kernie et al., 2000; Lebrun et al., 2006). ), а экзогенное введение BDNF оказывает гипофагическое действие (Rios, 2013), в то время как делеция BDNF имеет гиперфагическое действие, приводящее к тяжелому ожирению (Gray et al., 2006). Кроме того, ген BDNF функционально связан со снижением доступного BDNF примерно на 33%, и модели на животных показывают, что анорексигенный эффект BDNF опосредован его модулирующим воздействием на меланокортин/лептиновую систему, а также на системы нейротрансмиттеров дофамина и серотонина. (Бариохай и др., 2005). В соответствии с этими исследованиями на животных и людях мы обнаружили, что молодые люди с гипофункционирующими аллелями Met сообщают о большем потреблении энергии в виде жира и белка, и, хотя это не является статистически значимым, мы наблюдали тенденции (90 839 p 90 840 = 0,07) к более высокому общему потреблению калорий. по сравнению с гомозиготными носителями Val-аллеля. Избыток энергии примерно в 175 ккал, наблюдаемый у носителей аллеля Met, если он сохраняется с течением времени и без компенсирующего увеличения расхода энергии или метаболических адаптаций, может привести к увеличению веса, что соответствует исследованиям на взрослых людях, показывающим, что генетически обусловленное снижение BDNF связаны с расстройством пищевого поведения (Gratacòs et al., 2007) и гиперфагия (Gray et al., 2006). Тем не менее, следует отметить, что носители аллеля Met также демонстрировали тенденцию к более высокой безжировой массе (2,4 кг), что, как было показано, является сильным предиктором более высоких потребностей и потребления энергии (Cameron et al., 2016). Однако в нашем исследовании невозможно установить, будет ли более высокая безжировая масса, которая может быть частично обусловлена ​​более высокой массой тела (1,4 кг), полностью компенсировать более высокое потребление энергии, что подчеркивает необходимость того, чтобы будущие исследования включали строгие измерения обоих факторов. расход энергии и потребление энергии, чтобы лучше оценить риск увеличения веса и ожирения.

Мы также обнаружили, что гипофункциональные носители аллеля BDNF Met полиморфизма Val66Met не только сообщили о более высоком потреблении энергии, но также показали примерно на 50% более высокие уровни C-реактивного белка (CRP) натощак и тенденцию к более низким уровням HDL-C в крови по сравнению с к Вал-носителям. Это имеет клиническое значение, учитывая, что CRP и HDL-C являются одними из самых надежных биомаркеров хронического воспаления и кардиометаболических заболеваний (van Holten et al., 2013). Более высокие уровни СРБ, связанные с носителями аллеля Met полиморфизма BDNF, свидетельствуют о том, что влияние BDNF на патофизиологию сердечно-сосудистых заболеваний, выявленное у взрослых (Lorgis et al., 2009; Pius-Sadowska and Machaliński, 2017) действительно может возникать в подростковом возрасте. В подтверждение этой взаимосвязи у людей-носителей Val/Met с нестабильной стенокардией значительно повышен CRP в плазме по сравнению с носителями Met/Met с нестабильной стенокардией (Jiang et al., 2009). Соответственно, мы обнаружили, что носители аллеля Met демонстрируют более низкий уровень холестерина ЛПВП по сравнению с носителями Val/Val, что согласуется с данными, полученными среди взрослых из Китая (Peng et al., 2017), в то время как другое исследование на взрослых показало, что гомозиготные носители аллеля Met были 2.в 8 раз больше подвержены риску метаболического синдрома, ассоциация, которая осталась после корректировки ИМТ (Rana et al., 2019).

Очень немногие другие педиатрические исследования изучали взаимосвязь между генотипом BDNF, потреблением энергии и факторами риска сердечно-сосудистых заболеваний. Наши выводы в некоторой степени согласуются с данными Kalenda et al. (2018), которые обнаружили, что в постпубертатном (но не в препубертатном) возрасте носители аллеля Met также сообщали о повышенном потреблении калорий, углеводов и белков. Интересно, что эта модель пищевого поведения у Kalenda et al.(2018) было связано с более низкими постпрандиальными уровнями глюкозы и HbA1C среди носителей аллеля Met. Кроме того, недавнее исследование с участием 308 сербских подростков со средним ИМТ в диапазоне здоровых значений показало, что у носителей аллеля Met наблюдался более низкий уровень глюкозы в крови натощак по сравнению с носителями Val, причем этот эффект определяли женщины, а не мужчины (Vidovic et al. др., 2020). Эти результаты свидетельствуют о том, что в детстве BDNF, по-видимому, влияет на потребление энергии, предпочтение макронутриентов и регулирование уровня глюкозы, ранее установленное в основном в исследованиях на животных (Kernie et al., 2000; Лебрен и др., 2006). Следует отметить, что различия в характере результатов между нашим исследованием HEARTY и исследованием Kalenda et al. (2018) и Vidovic et al. (2020) может быть отчасти связано с различиями в характеристиках выборки. Например, наше исследование включало неактивных канадских подростков постпубертатного возраста, которые были преимущественно женского пола (74%), белых (67%) и происходили от родителей с высшим образованием (83%). Другие выборки исследования состояли из более социально-экономически разнообразных и более этнически однородных (т.e., белые) европейские дети и подростки, набранные из сообщества в препубертатном и постпубертатном возрасте, в том числе молодые люди с ожирением и без него или подверженные риску расстройств пищевого поведения (Arija et al., 2010; Skledar et al. ., 2012; Календа и др., 2018; Видович и др., 2020). Однако следует отметить, что социально-демографические характеристики, такие как возраст, пол, образование родителей, этническая принадлежность или пубертатный статус, не различались в зависимости от генотипа BDNF в нашей выборке и, следовательно, вряд ли могут объяснить наблюдаемые различия.Различия результатов между исследованиями также могут быть связаны с популяционно-генетическими различиями в полиморфизме Val66Met (Shen et al., 2018). Тем не менее, наши результаты, показывающие, что генотипы BDNF, связанные с подавлением уровней зрелого BDNF через Trk, также связаны с повышенными уровнями CRP, согласуются с нашей предыдущей работой, показывающей, что вызванное физическими упражнениями повышение уровня BDNF в сыворотке связано со снижением кардиометаболического риска у молодежь с ожирением (Walsh et al., 2018). Эти результаты также согласуются с исследованиями на взрослых и животных, в которых BDNF участвует в регуляции системного воспаления, утилизации и контроле глюкозы (Kernie et al., 2000; Цзян и др., 2009 г.; Штейн и др., 2017).

Предлагается несколько молекулярных механизмов, объясняющих наши метаболические данные. Мышиные модели человеческого полиморфизма Val66Met BDNF предполагают, что этот провоспалительный фенотип частично опосредован гиперкоагуляцией тромбоцитов и изменениями динамики высвобождения тромбоцитов-BDNF (Stein et al., 2017). Действительно, BDNF активирует рецептор TrkB, что приводит к целостности, выживанию и функционированию эндотелиальных клеток сосудов (Donovan et al., 1995; Prigent-Tessier et al., 2013) и формирование сердечной сосудистой сети (Emanueli et al., 2014). BDNF действует как регулятор ангиогенеза, стимулируя ангиогенез (Kermani et al., 2005). Изменения во взаимодействиях тромбоцитов и BDNF с эндотелием сосудов в сочетании с провоспалительным состоянием могут способствовать повышенному риску сердечно-сосудистых заболеваний, связанных с гипофункциональным полиморфизмом BDNF через TrkB. Однако следует отметить, что BDNF первоначально синтезируется в эндоплазматическом ретикулуме в виде его белка-предшественника, preproBDNF, который становится proBDNF, который затем преобразуется внеклеточными протеазами в зрелый BDNF (Ethel and Ethel, 2007; Yoshida et al., 2013; László et al., 2019) ProBDNF биологически активен: он опосредует свои действия посредством связывания с низкоаффинным p75Ntr, оказывая антагонистическое действие по сравнению со зрелым BDNF. Это снижает сложность и плотность позвоночника (Zagrebelsky et al., 2005) и способствует гибели нейронов (Teng et al., 2005). Особое значение имеют предшественники генов BDNF, такие как продомен Val66 BDNF и продомен Met66 BDNF (Zanin et al., 2017), которые являются лигандами, секретируемыми нейронами, которые могут выполнять потенциальные функции, когда ген BDNF активен.Met-вариантный продомен BDNF резко изменяет морфологию нейронов, вызывая изменения в конусах роста нейронов (Anastasia et al., 2013). Это изменение в процессинге BDNF продомена Met может представлять собой еще один возможный механизм, который объясняет наши выводы о том, что носители аллеля Met демонстрируют большее потребление энергии и метаболический риск по сравнению с носителями аллеля Val. Однако следует отметить, что полиморфизм Val66Met является высококонсервативным, и было показано, что лиганд BDNF продомена Val66 снижает плотность дендритных шипов в нейронах гиппокампа и способствует длительной депрессии гиппокампа (Guo et al., 2016), эффект, который притупляется продоменом Met BDNF (Mizui et al., 2016). Это подчеркивает, что лиганд продомена Met66 может давать избирательные преимущества структуре и пластичности гиппокампа, что также может частично объяснить результаты, согласно которым носители аллеля Met демонстрируют более низкий риск кардиометаболических заболеваний у детей (Kalenda et al., 2018; Vidovic et al. al., 2020), более низкий ИМТ у здоровых взрослых (Sustar et al., 2016), а также меньшее количество сердечно-сосудистых событий и более легкая степень тяжести сердечно-сосудистых заболеваний у взрослых кардиологических пациентов (Jiang et al., 2017).

Наше исследование имеет несколько сильных и слабых сторон, которые важно признать. Во-первых, наша выборка состояла из неактивных, постпубертатных молодых людей, живущих с избыточным весом или ожирением и страдающих ожирением, которые в основном были белыми, женщинами и происходили от хорошо образованных родителей, поэтому результаты нельзя обобщать для всех подростков с избыточной массой тела или без нее. ожирение. Во-вторых, наши данные носят перекрестный характер, поэтому причинно-следственная связь или направленность не могут быть выведены, что подчеркивает необходимость включения в будущие исследования лонгитюдных планов с многочисленными последующими наблюдениями для лучшего установления направленности.В-третьих, мы оценили потребление энергии на основе стандартизированных журналов приема пищи, и, несмотря на то, что они были подтверждены зарегистрированным диетологом, нельзя сбрасывать со счетов предвзятость в отчетах. Хотя между носителями и не носителями аллеля Val66Met не было различий по демографическим, антропометрическим факторам или факторам образа жизни, возможны дополнительные факторы окружающей среды (например, стресс, травма, депрессия и т. д.), которые не были учтены в нашем дизайне и исследовании. анализ мог повлиять на результаты через взаимодействий генов и окружающей среды, учитывая их связь с BDNF (Zhao et al., 2018). Кроме того, хотя размер нашей выборки обеспечивает достаточную мощность для выявления эффектов среднего размера, он считается несколько небольшим для генетических исследований, и это могло ограничить нашу статистическую мощность для обнаружения меньших эффектов, а также для изучения анализов чувствительности, таких как сдерживающее влияние пола. или этническая принадлежность. Из-за новизны нашего исследования и скудости исследований в педиатрии мы не хотели быть чрезмерно консервативными, контролируя множественные сравнения, которые увеличили бы шансы не обнаружить групповые различия, когда они существуют (т.д., ошибка второго рода). Тем не менее, будущие исследования, направленные на воспроизведение этих результатов, возможно, пожелают скорректировать для множественного сравнения, чтобы защитить от возможности увеличения шансов получения значимых результатов случайно (ошибка типа I). Наконец, мы не измеряли сывороточный BDNF, аппетит или расход энергии, которые должны быть включены в будущие исследования, чтобы обеспечить лучшее понимание того, как полиморфизм BDNF функционально влияет на сывороточные уровни BDNF и как это связано с энергетическим балансом, составом тела и здоровьем. сопутствующие метаболические заболевания в молодости.Сильные стороны нашего исследования включали его новизну и клиническую выборку молодых людей с высоким риском ожирения, которые демонстрируют более высокую частоту осложнений, связанных с BDNF, таких как нейрокогнитивный дефицит (Liang et al., 2016) и метаболическая дисрегуляция (Krabbe et al., 2007). по сравнению со сверстниками без ожирения. Кроме того, в отличие от других исследований, мы не полагались исключительно на показатели состава тела на основе ИМТ, а вместо этого использовали МРТ, которая обеспечивает более точное измерение и более надежную связь с осложнениями, связанными с ожирением, чем ИМТ (Mitra et al., 2017), укрепляя внутреннюю валидность выводов.

В заключение, мы обнаружили, что носители Met-аллелей полиморфизма BDNF Val66Met демонстрировали значительно и клинически значимо (50%) более высокий СРБ и потребление энергии в виде жиров и белков с тенденцией к более высокому общему потреблению энергии, жиро- свободная масса и более низкий уровень холестерина ЛПВП по сравнению с носителями гомозиготного Val-аллеля. Учитывая, что молодые люди с ожирением подвержены повышенному риску кардиометаболических нарушений во взрослом возрасте, а BDNF участвует в потреблении энергии и нарушении регуляции метаболизма, как описано выше, необходимы дальнейшие исследования, чтобы подтвердить наши выводы и определить, являются ли носители этого полиморфизма BDNF генетически предрасположенными к увеличению потребление энергии, увеличение веса и метаболические осложнения.В эпоху персонализированной медицины эта информация необходима для информирования о стратегиях раннего вмешательства, направленных на оптимизацию детского ожирения и профилактику и лечение хронических заболеваний.

Заявление о доступности данных

Необработанные данные, подтверждающие выводы этой статьи, будут предоставлены авторами без неоправданных оговорок.

Заявление об этике

Исследования с участием людей были рассмотрены и одобрены Советом по этике исследований Детской больницы Восточного Онтарио (протокол № 05/04E) и Советом по этике исследований Научно-исследовательского института больницы Оттавы (протокол № 2004219-01H).Письменное информированное согласие на участие в этом исследовании было предоставлено законным опекуном/ближайшим родственником участников.

Вклад авторов

GG задумал исследование и участвовал в его разработке и координации, а также подготовил рукопись. JW, SH и DG помогли подготовить и критически просмотреть рукопись. RS, GK и DP задумали исследование и участвовали в его разработке и координации, а также помогли составить проект и критически рассмотреть рукопись. ML руководил генотипированием и помог составить и критически просмотреть рукопись.MN провел генотипирование, помог составить и критически просмотреть рукопись. АА помог со сбором данных, а также с черновиком и критическим обзором рукописи. С.Д. провел статистический анализ и помог составить черновик и критически просмотреть рукопись. JC помог задуматься об исследовании, его дизайне и координации, а также помог составить проект и критически просмотреть рукопись. Все авторы прочитали и одобрили окончательный вариант рукописи и согласны с порядком изложения авторов.

Финансирование

GG был поддержан премией нового исследователя от Канадского института исследований в области здравоохранения за часть этого испытания, а затем заведующим научно-исследовательским отделом Совета ассоциации волонтеров Детской больницы Восточного Онтарио. RS был поддержан премией Health Senior Scholar от Alberta Innovates-Health Solutions, а ранее во время части этого испытания его поддерживал научный руководитель Исследовательского института больницы Оттавы. GK поддержала кафедра университетских исследований Университета Оттавы.АА была поддержана премией для докторантов Канадской диабетической ассоциации и в настоящее время премией FRQ-S Chercheur Boursier Junior 1.

Конфликт интересов

Авторы заявляют, что исследование проводилось при отсутствии каких-либо коммерческих или финансовых отношений, которые могли бы быть истолкованы как потенциальный конфликт интересов.

Примечание издателя

Все претензии, изложенные в этой статье, принадлежат исключительно авторам и не обязательно представляют претензии их дочерних организаций или издателя, редакторов и рецензентов.Любой продукт, который может быть оценен в этой статье, или претензии, которые могут быть сделаны его производителем, не гарантируются и не поддерживаются издателем.

Благодарности

Мы хотели бы поблагодарить участников испытания HEARTY, а также Кристу Хинд (умерла), Бруно Лемира, Марту Вейн, Ким Робертсон, Ким Фетч, Бриттани Хэнлон, Джейн Ярдли, Надю Балаа, Карен Лопес, Памелу Мартино, Ким Морин, Коллин Гилкрист, Паскаль Мессье, Келли Филлипс и студенты Школы кинетики человека Университета Оттавы, которые внесли свой вклад в координацию обучения, тренировки и оценку участников исследования.Роберт Росс (Университет Квинса, Кингстон, Онтарио, Канада), Элисон Брэдшоу и Дженнифер Кук (Университет Йорка, Торонто, Онтарио, Канада), а также Ив Мартель (Tomovision, Magog, QC, Канада) помогали в обучении и постоянно давали советы по анализ состава тела. Оттава-Карлтонский региональный YMCA/YWCA (Оттава, Онтарио, Канада), Центр RA (Оттава, Онтарио, Канада), Детская больница Восточного Онтарио, а также Nautilus Plus и MRI Plus (оба в Гатино, Квебек, Канада) сотрудничали на протяжении пробный.

Сноски

Каталожные номера

Альберга, А.С., Голдфилд, Г.С., Кенни, Г.П., Хаджияннакис, С., Филлипс, П., Пруд’Хомм, Д., и др. (2012). Здоровое питание, аэробные упражнения и тренировки с отягощениями в юности (HEARTY): обоснование, дизайн и методы исследования. Контемп. клин. Испытания 33, 839–847.

Академия Google

Альберга, А. С., Пруд’Хомм, Д., Кенни, Г. П., Голдфилд, Г. С., Хаджияннакис, С., Гужон, Р., и соавт. (2015). Влияние аэробных тренировок и тренировок с отягощениями на абдоминальный жир, аполипопротеины и высокочувствительный С-реактивный белок у подростков с ожирением: рандомизированное клиническое исследование HEARTY. Междунар. Дж. Обес. 39, 1494–1500.

Академия Google

Анастасия А., Дейнхардт К., Чао М.В., Уилл Н.Е., Ирмади К., Ли Ф.С. и соавт. (2013). Полиморфизм Val66Met BDNF изменяет структуру продомена, вызывая ретракцию конуса роста нейронов. Нац. коммун. 4:2490. дои: 10.1038/NCOMMS3490

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Ария, В., Феррер-Баркала, М., Аранда, Н., и Каналс, Дж. (2010). Полиморфизм BDNF Val66Met, потребление энергии и ИМТ: последующее исследование школьников с риском расстройств пищевого поведения. BMC Public Health 10:363. дои: 10.1186/1471-2458-10-363

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Bariohay, B., Lebrun, B., Moyse, E., and Jean, A. (2005). Нейротрофический фактор головного мозга играет роль анорексигенного фактора в дорсальном блуждающем комплексе. Эндокринология 146, 5612–5620. doi: 10.1210/en.2005-0419

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Кэмерон, Дж. Д., Сигал, Р. Дж., Кенни, Г.П., Альберга А.С., Пруд’Хомм Д., Филлипс П. и соавт. (2016). Состав тела и потребление энергии – масса скелетных мышц является самым сильным предиктором потребления пищи подростками с ожирением: исследование HEARTY. Заяв. Физиол. Нутр. Метаб. 41, 611–617.

Академия Google

Карлино Д., Леоне Э., Ди Кола Ф., Бай Г., Марин Р., Динелли Г. и др. (2011). Низкий уровень изоформы укороченного BDNF в сыворотке крови коррелирует с более высокими когнитивными нарушениями при шизофрении. J. Psychiatr.Рез. 45, 273–279. doi: 10.1016/j.jpsychires.2010.06.012

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Коэн, Дж. (1977). Статистический анализ мощности для поведенческих наук. Нью-Йорк, штат Нью-Йорк: Лоуренс Эрлбаум.

Академия Google

Ди Чезаре М., Сорич М., Бовет П., Миранда Дж. Дж., Бхутта З., Стивенс Г. А. и соавт. (2019). Эпидемиологическое бремя ожирения у детей: всемирная эпидемия, требующая неотложных действий. БМС Мед. 17:212. doi: 10.1186/s12916-019-1449-8

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Донован, М.Дж., Миранда, Р.К., Кремер, Р., Маккефри, Т.А., Тессаролло, Л., Махадео, Д., и соавт. (1995). Нейротрофин и рецепторы нейротрофина в гладкомышечных клетках сосудов: регуляция экспрессии в ответ на повреждение. утра. Дж. Патол. 147, 309–324.

Академия Google

Иган М., Кодзима М., Калликотт Дж., Голдберг Т.Э., Колачана Б.С., Бертолино А. и соавт. (2003). Полиморфизм BDNF val66met влияет на зависимую от активности секрецию BDNF, память человека и функцию гиппокампа. сотовый 112, 257–269.

Академия Google

Эмануэли, К., Мелони, М., Хасан, В., и Хабекер, Б. А. (2014). «Биология нейротрофинов: сердечно-сосудистая функция», в Neurotrophic Factors , eds G. Lewin and B. Carter (Berlin: Springer), 309–328. дои: 10.1007/978-3-642-45106-5

Полнотекстовая перекрестная ссылка | Академия Google

Этель, И.и Этель, Д. (2007). Матриксные металлопротеиназы в развитии и ремоделировании мозга: синаптические функции и мишени. J. Neurosci. Рез. 85, 2813–2823.

Академия Google

Friedel, S., Fontenla Horro, F., Wermter, A.K., Geller, F., Dempfle, A., Reichwald, K., et al. (2005). Скрининг мутаций гена нейротрофического фактора головного мозга (BDNF): идентификация нескольких генетических вариантов и ассоциативные исследования у пациентов с ожирением, расстройствами пищевого поведения и синдромом дефицита внимания/гиперактивности. утра. Дж. Мед. Жене. Часть B Нейропсихология. Жене. 132Б, 96–99. doi: 10.1002/ajmg.b.30090

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Фридевальд, В.Т., Леви, Р.И., и Фредриксон, Д.С. (1972). Оценка концентрации холестерина липопротеидов низкой плотности в плазме без применения препаративной ультрацентрифуги. клин. хим. 18, 499–502.

Академия Google

Голдфилд, Г. С., Кенни, Г. П., Альберга, А.С., Пруд’Хомм Д., Хаджияннакис С., Гужон Р. и др. (2015). Влияние аэробных тренировок, силовых тренировок или того и другого на психологическое здоровье подростков с ожирением: рандомизированное контролируемое исследование HEARTY. Дж. Консалт. клин. Психол. 83, 1123–1135.

Академия Google

Goldfield, G.S., Kenny, G.P., Alberga, A.S., Tulloch, H.E., Doucette, S., Cameron, J.D., et al. (2017). Влияние аэробных тренировок или тренировок с отягощениями на связанное со здоровьем качество жизни молодых людей с ожирением: исследование HEARTY. Заяв. Физиол. Нутр. Метаб. 42, 361–370.

Академия Google

Гратакос, М., Гонсалес, Дж. Р., Меркадер, Дж. М., де Сид, Р., Урретавиская, М., и Эстивилл, X. (2007). Нейротрофический фактор головного мозга Val66Met и психические расстройства: метаанализ исследований случай-контроль подтверждает связь с расстройствами, связанными с употреблением психоактивных веществ, расстройствами пищевого поведения и шизофренией. биол. Психиатрия 61, 911–922. doi: 10.1016/j.biopsych.2006.08.025

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Грей, Дж., Yeo, G.S.H., Cox, J.J., Morton, J., Adlam, A.L.R., Keogh, J.M., et al. (2006). Гиперфагия, тяжелое ожирение, нарушение когнитивных функций и гиперактивность, связанные с функциональной потерей одной копии гена нейротрофического фактора головного мозга (BDNF). Диабет Метаб. Рез. Ред. 55, 3366–3371. дои: 10.2337/db06-0550

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Guo, J., Ji, Y., Ding, Y., Jiang, W., Sun, Y., Lu, B., et al. (2016). Пропептид BDNF регулирует дендритные шипы через каспазу-3. Дис. клеточной смерти. 7:e2264. doi: 10.1038/cddis.2016.166

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Цзян Х., Ван Р., Лю Ю., Чжан Ю. и Чен З.Ю. (2009). Полиморфизм BDNF Val66Met связан с нестабильной стенокардией. клин. Чим. Акта 400, 3–7. doi: 10.1016/j.cca.2008.10.017

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Цзян Р., Бабяк М. А., Брамметт Б. Х., Хаузер Э. Р., Шах С.H., Becker, R.C., et al. (2017). Полиморфизм мозгового нейротрофического фактора rs6265 (Val66Met) связан с тяжестью заболевания и частотой сердечно-сосудистых событий в когорте пациентов. утра. Heart J. 190, 40–45. doi: 10.1016/j.ahj.2017.05.002

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Календа А., Ландграф К., Леффлер Д., Ковач П., Кисс В. и Кёрнер А. (2018). Полиморфизм BDNF Val66Met связан с более низким ИМТ, более низким уровнем постпрандиальной глюкозы и повышенным потреблением углеводов у детей и подростков. Педиатр. Обес. 13, 159–167. doi: 10.1111/ijpo.12238

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Кермани П., Раффи Д., Джин Д., Уитлок П., Шаффер В., Чанг А. и др. (2005). Нейротрофины способствуют реваскуляризации за счет локального рекрутирования. Дж. Клин. Вкладывать деньги. 115, 653–663.

Академия Google

Керни, С.Г., Либл, Д.Дж., и Парада, Л.Ф. (2000). BDNF регулирует пищевое поведение и двигательную активность мышей. EMBO J. 19, 1290–1300.

Академия Google

Krabbe, K.S., Nielsen, A.R., Krogh-Madsen, R., Plomgaard, P., Rasmussen, P., Erikstrup, C., et al. (2007). Нейротрофический фактор головного мозга (BDNF) и диабет 2 типа. Диабетология 50, 431–438.

Академия Google

Ласло, А., Ленарт, Л., Иллеси, Л., Фекете, А., и Немчик, Дж. (2019). Роль нейротрофинов в психопатологии и сердечно-сосудистых заболеваниях: психосоматические связи. Дж. Нейрал. Трансм. 126, 265–278. doi: 10.1007/s00702-019-01973-6

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Лезердейл, С. Т., и Харви, А. (2015). Изучение малоподвижного поведения канадской молодежи, основанного на общении и средствах массовой информации: результаты исследования COMPASS. Пред. Мед. 74, 74–80.

Академия Google

Лебрен, Б., Бариохай, Б., Мойс, Э., и Джин, А. (2006). Нейротрофический фактор головного мозга (BDNF) и регуляция приема пищи: мини-обзор. Автон. Неврологи. 126–127, 30–38. doi: 10.1016/j.autneu.2006.02.027

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Леон-Мимила, П., Вильямиль-Рамирес, Х., Вильялобос-Компаран, М., Вильярреал-Молина, Т., Ромеро-Идальго, С., Лопес-Контрерас, Б., и другие. (2013). Вклад общих генетических вариантов в ожирение и связанные с ожирением черты у мексиканских детей и взрослых. PLoS One 8:e70640. doi: 10.1371/journal.pone.0070640

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Лян, Дж., Matheson, B.E., Kaye, W.H., и Boutelle, K.N. (2016). Нейрокогнитивные корреляты ожирения и поведения, связанного с ожирением, у детей и подростков. Междунар. Дж. Обес. 38, 494–506.

Академия Google

Лоргис, Л., Амуре, С., Вергели, К., Зеллер, М., Коттин, Ю., и Рошетт, Л. (2009). Мозговой нейротрофический фактор (BDNF): роль этого нейротрофина в сердечно-сосудистой физиопатологии. Энн. Кардиол. д’Анжоль. 58, 99–103. doi: 10.1016/j.ancard.2008.11.001

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Марози, К., и Маттсон, член парламента (2014). BDNF опосредует адаптивные реакции мозга и тела на энергетические вызовы. Тенденции Эндокринол. Метаб. 25, 89–98.

Академия Google

Мартинес-Эскерро, Х.Д., Рендон-Масиас, М.Е., Самора-Мендоса, Г., Серрано-Менесес, Дж., Росалес-Родригес, Б., Эскаланте-Баутиста, Д., и др. (2017). Связь между полиморфизмом нейротрофического фактора головного мозга Val66Met и избыточным весом/ожирением у детей. Арх. Мед. Рез. 48, 599–608. doi: 10.1016/j.arcmed.2018.02.005

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Мэтьюз, В.Б., Астром, М.Б., Чан, М.Х., Брюс, К.Р., Краббе, К.С., Преловсек, О., и соавт. (2009). Нейротрофический фактор головного мозга вырабатывается клетками скелетных мышц в ответ на сокращение и усиливает окисление жиров за счет активации АМФ-активируемой протеинкиназы. Диабетология 52, 1409– 1418.

Академия Google

Макнил, Дж., Lamothe, G., Cameron, J.D., Riou, M.-E., Cadieux, S., Lafrenière, J., et al. (2017). Изучение предикторов приема пищи: действительно ли уровень метаболизма в состоянии покоя является самым сильным показателем потребления энергии? утра. Дж. Клин. Нутр. 106, 1206–1212. doi: 10.3945/ajcn.117.153718

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Митра, С., Фернандес-Дель-Валле, М., и Хилл, Дж. Э. (2017). Роль МРТ в понимании основных механизмов заболеваний, связанных с ожирением. Биохим. Биофиз. Acta 1863, 1115–1131. doi: 10.1016/j.bbadis.2016.09.008

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Мизуи Т., Исикава Ю., Куманогох Х., Люмэ М., Мацумото Т., Хара Т. и др. (2016). Действия пропептида BDNF облегчают LTD гиппокампа и изменяются общим полиморфизмом BDNF Val66Met. Проц. Натл акад. науч. США 112, E3067–E3074. doi: 10.1073/pnas.1422336112

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Пэн, Дж.H., Liu, C.W., Pan, S.L., Wu, H.Y., Liang, Q.H., Gan, R.J., et al. (2017). Потенциальные неблагоприятные воздействия полиморфизмов BDNF Val66Met на метаболические риски в средней популяции в долгожительском регионе. BMC Гериатр. 17:4. doi: 10.1186/s12877-016-0393-0

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Послусна, К., Руприч, Дж., Де Врис, Дж. Х. М., Якубикова, М., и Ван’Т Веер, П. (2009). Неправильные отчеты о потреблении энергии и питательных микроэлементов, оцененные с помощью записей о пищевых продуктах и ​​24-часовых отзывов, методов контроля и корректировки на практике. Бр. Дж. Нутр. 101 (Прил. 2), S73–S85. дои: 10.1017/S00071145099

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Прижан-Тессье, А., Куири, А., Магуин-Гейт, К., Шостак, Дж., Моссиат, К., Наппи, М., и соавт. (2013). Физические тренировки и артериальная гипертензия оказывают противоположное влияние на экспрессию эндотелиального нейротрофического фактора головного мозга. Сердечно-сосудистые заболевания. Рез. 100, 374–382. Дои: 10.1093/cvr/cvt219

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Рана, С., Султана, А., и Бхатти, А.А. (2019). Ассоциация BDNF rs6265 и MC4R rs17782313 с метаболическим синдромом у пакистанцев. J. Biosci. 44, 95. doi: 10.1007/s12038-019-9915-1

Полнотекстовая перекрестная ссылка | Академия Google

Росс Р., Леже Л., Моррис Д., де Гиз Дж. и Гуардо Р. (1992). Количественная оценка жировой ткани с помощью МРТ: связь с антропометрическими переменными. J. Appl. Физиол. 72, 787–795.

Академия Google

Шейх Х.И., Хайден, Э.П., Крыски, К.Р., Смит, Х.Дж., и Сингх, С.М. (2010). Генотипирование полиморфизма BDNF rs6265 (val66met) с помощью одноэтапной ПЦР с амплифицированной рефрактерной мутационной системой. Психиатр. Жене. 20, 109–112. дои: 10.1097/YPG.0b013e32833a2038

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Шен, Т., Ю, Ю., Джозеф, К., Мирзаи, М., Клисторнер, А., Грэм, С.Л., и соавт. (2018). Полиморфизм BDNF: обзор его диагностической и клинической значимости при нейродегенеративных заболеваниях. Старение Dis. 9, 523–536. doi: 10.14336/AD.2017.0717

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Shugart, Y.Y., Chen, L., Day, I.N.M., Lewis, S.J., Timpson, N.J., Yuan, W., et al. (2009). Два исследования британских женщин воспроизвели связь между полиморфизмом Val66Met нейротрофического фактора головного мозга (BDNF) и ИМТ. евро. Дж. Хам. Жене. 17, 1050–1055. doi: 10.1038/ejhg.2008.272

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Сигал, Р.Дж., Альберга А.С., Голдфилд Г.С., Прюдомм Д., Хаджияннакис С., Гужон Р. и др. (2014). Влияние аэробных тренировок, тренировок с отягощениями или обоих на процент жира в организме и маркеры кардиометаболического риска у подростков с ожирением: рандомизированное клиническое исследование здорового питания, аэробики и тренировок с отягощениями у молодежи. JAMA Педиатр. 168, 1006–1014.

Академия Google

Скледар М., Николац М., Додиг-Чуркович К., Куркович М., Боровецкий Ф. и Пивак Н.(2012). Связь между мозговым нейротрофическим фактором Val66Met и ожирением у детей и подростков. Прог. Нейро Психофармак. биол. Психиатрия 36, 136–140.

Академия Google

Штейн, С., Винник, С., и Маттер, К.М. (2017). Полиморфизм мозгового нейротрофического фактора Val66Met при депрессии и тромбозе: SIRT1 как возможный медиатор. евро. Харт Дж. 38, 1436–1438. doi: 10.1093/eurheartj/ehv692

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Сустар, А., Николак Перкович, М., Недич Эрьявец, Г., Свобод Страк, Д., и Пивак, Н. (2016). Защитный эффект генотипа BDNF Met/Met при ожирении у здоровых лиц европеоидной расы, но не у пациентов с ишемической болезнью сердца. евро. преподобный мед. Фармакол. науч. 20, 3417–3426.

Академия Google

Табачник, Б.Г., и Фиделл, Л.С. (2007). Использование многомерной статистики , 5-е изд. Бостон, Массачусетс: Аллин и Бэкон.

Академия Google

Тэн, Х.К., Тенг К.К., Ли Р., Райт С., Тевар С., Алмейда Р.Д. и соавт. (2005). ProBDNF индуцирует апоптоз нейронов посредством активации рецепторного комплекса p75NTR и сортилина. J. Neurosci. 25, 5455–5463. doi: 10.1523/JNEUROSCI.5123-04.2005

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Цучида А., Накагава Т., Итакура Ю., Ичихара Дж., Огава В., Касуга М. и др. (2001). Влияние нейротрофического фактора головного мозга на передачу сигнала инсулина в печени мышей с диабетом. Диабетология 44, 555–566. дои: 10.1007/s001250051661

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

van Holten, T.C., Waanders, L.F., de Groot, P.G., Vissers, J., Hoefer, I.E., Pasterkamp, ​​G., et al. (2013). Циркулирующие биомаркеры для прогнозирования риска сердечно-сосудистых заболеваний; систематический обзор и всесторонний обзор мета-анализов. PLoS One 8:e62080. doi: 10.1371/journal.pone.0062080

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Видович, В., Максимович Н., Новакович И., Дамнянович Т., Екич Б., Видович С. и соавт. (2020). Связь полиморфизма мозгового нейротрофического фактора Val66Met с индексом массы тела, уровнем глюкозы натощак и липидным статусом у подростков. Балкан J. Med. науч. 23, 77–82.

Академия Google

Войнескос, А. Н., Лерх, Дж. П., Фельский, Д., Шейх, С., Раджи, Т. К., Миранда, Д., и соавт. (2011). Полиморфизм нейротрофического фактора головного мозга Val66Met и прогнозирование нервного риска болезни Альцгеймера. Арх. Общая психиатрия 68, 198–206. doi: 10.1001/archgenpsychiatry.2010.194

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Уолш, Дж. Дж., Д’Ангиулли, А., Кэмерон, Дж. Д., Сигал, Р. Дж., Кенни, Г. П., Холцик, М., и соавт. (2018). Изменения в мозговом нейротрофическом факторе связаны с улучшением факторов риска диабета после физических упражнений у подростков с ожирением: рандомизированное контролируемое исследование HEARTY. Нейропласт. 2018, 7169583.дои: 10.1155/2018/7169583

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Веллман, Н.С., и Фридберг, Б. (2002). Причины и последствия ожирения среди взрослых: медицинские, социальные и экономические последствия в США. Азиатско-Тихоокеанский регион. Дж. Клин. Нутр. 11, С705–С709. doi: 10.1046/j.1440-6047.11.s8.6.x

Полнотекстовая перекрестная ссылка | Академия Google

Всемирная медицинская ассоциация (2013 г.). Хельсинкская декларация Всемирной медицинской ассоциации об этических принципах медицинских исследований с участием людей. JAMA 310, 2191–2194. doi: 10.1001/jama.2013.281053

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Ву, Л., Си, Б., Чжан, М., Шэнь, Ю., Чжао, X., Ченг, Х., и соавт. (2010). Ассоциации шести однонуклеотидных полиморфизмов в генах, связанных с ожирением, с ИМТ и риском ожирения у китайских детей. Диабет Метаб. Рез. Ред. 59, 3085–3089. doi: 10.2337/db10-0273

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Си, Б., Cheng, H., Shen, Y., Chandak, G.R., Zhao, X., Hou, D., et al. (2013). Исследование 11 локусов, связанных с ИМТ, идентифицированных в GWAS для ассоциации с центральным ожирением у китайских детей. PLoS One 8:e56472. doi: 10.1371/journal.pone.0056472

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Яманака М., Цучида А., Накагава Т., Нономура Т., Оно-Кишино М., Сугару Э. и др. (2007). Нейротрофический фактор головного мозга усиливает утилизацию глюкозы в периферических тканях мышей с диабетом. Сахарный диабет. Обес. Метаб. 9, 59–64. doi: 10.1111/j.1463-1326.2006.00572.x

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Йошида, Т., Исикава, М., Ниицу, Т., Наказато, М., Ватанабэ, Х., Сираиси, Т., и другие. (2013). Снижение сывороточных уровней зрелого нейротрофического фактора головного мозга (BDNF), но не его предшественника proBDNF, у пациентов с большим депрессивным расстройством. PLoS One 7:e42676. doi: 10.1371/journal.pone.0042676

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Загребельский, А., Holz, A., Dechant, G., Barde, Y., Bonhoefer, T., and Korte, M. (2005). Рецептор нейротрофина p75 отрицательно модулирует сложность дендритов и плотность шипов в нейронах гиппокампа. J. Neurosci. 25, 9989–9999.

Академия Google

Занин Дж. П., Унсайн Н. и Анастасия А. (2017). Факторы роста и пропептиды гормонов: неожиданные приключения продомена BDNF. J. Нейрохим. 141, 330–340. doi: 10.1111/jnc.13993

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Чжао, Дж., Bradfield, J.P., Li, M., Wang, K., Zhang, H., Kim, C.E., et al. (2009). Роль локусов, связанных с ожирением, выявленных в полногеномных ассоциативных исследованиях, в определении ИМТ у детей. Ожирение 17, 2254–2257. doi: 10.1038/oby.2009.159

Реферат PubMed | Полный текст перекрестной ссылки | Академия Google

Чжао, М., Чен, Л., Ян, Дж., Фанг, Д., Цю, X., Ма, Дж., и соавт. (2018). Полиморфизм BDNF Val66Met, жизненный стресс и депрессия: метаанализ взаимодействия генов и окружающей среды. Дж. Аффект. Беспорядок. 227, 226–235.

Академия Google

Совершенствование протокола компьютерной томографии всего тела у пациентов с травмами

  • 1.

    ВОЗ. Глобальное бремя болезней, 2004 г. Женева: Глобальное бремя болезней, 2004 г.; 2008.

    Google Scholar

  • 2.

    Hajibandeh S. Систематический обзор: влияние компьютерной томографии всего тела на смертность у пациентов с травмами. J Inj Violence Res. 2015;7(2):64–74.

    ПабМед ПабМед Центральный Google Scholar

  • 3.

    Huber-Wagner S, Lefering R, Qvick LM, Korner M, Kay MV, Pfeifer KJ, et al. Влияние КТ всего тела во время реанимации при травмах на выживаемость: ретроспективное многоцентровое исследование. Ланцет. 2009;373(9673):1455–61.

    Артикул Google Scholar

  • 4.

    Caputo ND, Stahmer C, Lim G, Shah K. Компьютерное томографическое сканирование всего тела приводит к лучшей выживаемости по сравнению с селективным сканированием у пациентов с травмами: систематический обзор и метаанализ.J Травма неотложной помощи Surg. 2014;77(4):534–9.

    Артикул Google Scholar

  • 5.

    Clarke JR, Trooskin SZ, Doshi PJ, Greenwald L, Mode CJ. Время до лапаротомии при внутрибрюшном кровотечении из-за травмы влияет на выживаемость при задержках до 90 минут. J Травма. 2002;52(3):420–5.

    ПабМед Google Scholar

  • 6.

    Альбрехт Т., фон Шлиппенбах Дж., Штахель П.Ф., Эртель В., Вольф К.Я.Роль спиральной КТ всего тела в первичном обследовании пациентов с политравмой — сравнение с обычной рентгенографией и абдоминальной эхографией. Рофо. 2004;176(8):1142–50.

    КАС Статья Google Scholar

  • 7.

    Linsenmaier U, Krotz M, Hauser H, Rock C, Rieger J, Bohndorf K, et al. Компьютерная томография всего тела при политравме: методики и тактика. Евро Радиол. 2002;12(7):1728–40.

    Артикул Google Scholar

  • 8.

    Николя Б., Марсель Дж. Травматологический центр в Швейцарии. швейцарский нож. 2013;4:10–1.

    Google Scholar

  • 9.

    Hinzpeter R, Boehm T, Boll D, Constantin C, Del Grande F, Fretz V, et al. Алгоритмы визуализации и протоколы КТ у пациентов с травмами: обзор швейцарских центров неотложной помощи. Евро Радиол. 2017; 27(5):1922–8.

    КАС Статья Google Scholar

  • 10.

    Deutsche Gesellschaft für Unfallchirurgie.S3-leitlinie polytrauma/Schwerverletzten Behandlung [AWMF Register-Nr. 012/019. 2016. http://www.awmf.org/leitlinien. По состоянию на 02 мая 2021 г.

  • 11.

    Буйон Б., Пробст С., Мегеле М., Вафайсаде А., Хелм П., Мучлер М. и др. Управление отделениями неотложной помощи при множественных травмах: рекомендации ATLS(R) и S3. Хирург. 2013;84(9):745–52.

    КАС Статья Google Scholar

  • 12.

    Донаубауэр Б., Факлер Дж., Грис А., Кайзерс Ю.С., Йостен С., Бернхард М.Междисциплинарное ведение пациентов с травмами: обновление через 3 года после внедрения рекомендаций S3 по лечению пациентов с тяжелыми и множественными травмами. Анестезиолог. 2014;63(11):852–64.

    КАС Статья Google Scholar

  • 13.

    Kahn J, Grupp U, Maurer M. Как положение рук пациентов с политравмой при начальной компьютерной томографии (КТ) влияет на качество изображения и точность диагностики? Евр Дж Радиол. 2014;83(1):e67-71.

    Артикул Google Scholar

  • 14.

    Karlo C, Gnannt R, Frauenfelder T, Leschka S, Bruesch M, Wanner GA, et al. КТ всего тела у пациентов с политравмой: влияние положения рук на качество изображений грудной клетки и брюшной полости. Эмердж Радиол. 2011;18(4):285–93.

    Артикул Google Scholar

  • 15.

    Bayer J, Pache G, Strohm PC, Zwingmann J, Blanke P, Baumann T, et al.Влияние положения руки на дозу облучения при компьютерной томографии всего тела у пациентов с травмами. J Травма. 2011;70(4):900–5.

    ПабМед Google Scholar

  • 16.

    Бреннер Д.Дж., Эллистон CD. Расчетные радиационные риски, потенциально связанные с КТ-скринингом всего тела. Радиология. 2004; 232(3):735–8.

    Артикул Google Scholar

  • 17.

    Холл Э.Дж. Радиационная биология для детских рентгенологов.Педиатр Радиол. 2009; 39 (Приложение 1): S57-64.

    Артикул Google Scholar

  • 18.

    Linder F, Mani K, Juhlin C, Eklof H. Обычная КТ всего тела пациентов с высокоэнергетической травмой приводит к чрезмерному облучению. Scand J Trauma Resusc Emerg Med. 2016;24:7.

    Артикул Google Scholar

  • 19.

    Muirhead CR, O’Hagan JA, Haylock RG, Phillipson MA, Willcock T, Berridge GL, et al.Смертность и заболеваемость раком после профессионального радиационного облучения: третий анализ Национального реестра радиационных работников. Бр Дж Рак. 2009;100(1):206–12.

    КАС Статья Google Scholar

  • 20.

    Pauwels EK, Bourguignon MH. Особенности дозы облучения и индукции солидного рака в детской компьютерной томографии. Медицинская практика. 2012;21(6):508–15.

    Артикул Google Scholar

  • 21.

    фон Эльм Э., Альтман Д.Г., Эггер М., Покок С.Дж., Гоцше П.С., Ванденбрук Дж.П. Заявление об усилении отчетности об обсервационных исследованиях в эпидемиологии (STROBE): рекомендации по отчетности об обсервационных исследованиях. Int J Surg. 2014;12(12):1495–9.

    Артикул Google Scholar

  • 22.

    Подкомитет ATLS, Комитет по травмам Американского колледжа хирургов, Международная рабочая группа ATLS. Усовершенствованная система жизнеобеспечения при травмах (ATLS ® ): девятое издание.J Травма неотложной помощи Surg. 2013;74(5):1363–6.

    Google Scholar

  • 23.

    Speelman ES, Brocx B, Wilbers JE, de Bie MJ, Ivaschenko O, Tank Y, et al. Влияние положения рук на качество изображений брюшной полости при компьютерной томографии всего тела при травмах: систематический обзор. Эмердж Радиол. 2020;27(2):141–50.

    КАС Статья Google Scholar

  • 24.

    Бонгарц Г., Голдинг С.Дж., Юрик А.Г.Европейские рекомендации по мультиспиральной компьютерной томографии: приложение C. Финансируется Европейской комиссией. 2004. http://www.msct.eu/PDF_FILES/EC%20CA%20Report%20D5%20-%20Dosimetry.pdf По состоянию на 12 января 2009 г.

  • 25.

    Huda W, Ogden KM. Сравнение доз облучения головы и органов тела при КТ. физ.-мед. биол. 2008;53(2):N9-n14.

    Артикул Google Scholar

  • 26.

    Типнис С.В., Спампинато М.В., Хангерфорд Дж., Худа В. Дозы щитовидной железы и риски для взрослых пациентов, проходящих КТ шеи.AJR Am J Рентгенол. 2015; 204(5):1064–8.

    Артикул Google Scholar

  • 27.

    Meizoso JP, Ray JJ, Karcutskie C, Allen CJ, Zakrison TL, Pust GD, et al. Влияние времени до операции на смертность больных гипотензией с огнестрельными ранениями туловища: «Золотые 10 минут». J Травма неотложной помощи Surg. 2016;81(4):685–91.

    Артикул Google Scholar

  • 28.

    Коули Р.А.Общая система неотложной медицинской помощи для штата Мэриленд. Md State Med J. 1975; 24 (7): 37–45.

    КАС пабмед Google Scholar

  • 29.

    Harrois A, Hamada S, Laplace C, Duranteau J, Vigué B. Начальное лечение пациентов с тяжелой травмой при поступлении в больницу. Анн Фр Анест Реаним. 2013;32(7–8):483–91.

    КАС Статья Google Scholar

  • C10 Шайенн.B. Место для зубов гончих. час. Пикап Chevrolet C10 Cheyenne 1976 года V8 Small Block 3 Speed ​​Automatic. Хорошая покрасочная работа над прочным и конструктивно прочным кузовом. Объявления с 1 по 20 из 122. Продолжить чтение. добавить в избранное этот пост 13 января. Оригинальная бирка с номером VIN, прикрепленная к перчаточному ящику и двери. Этот Chevrolet C10 Cheyenne Super 1971 года — потрясающий винтажный пикап с правильными обновлениями, чтобы он оставался потрясающим круизером. 1968 GMC C10 Truck Short Bed Pro Touring Ls3. 61 000 долларов. 30 долларов. $29,500 ( ) фото скрыть эту публикацию восстановить восстановить эту публикацию.1974 Chevrolet C-10 Super Cheyenne C10 SWB: Состояние: б/у. 56 995 долларов. 16 – ничего не заменяет – у модели свои звуки двигателя – у модели есть анимация деталей модель пачкается – у модели свои колеса – Кабина комплектуется комплектацией Cheyenne с обшитым многоместным сиденьем. Годы выпуска: 1967–72. Это был год, когда у нас забрали Элвиса, но это был год, который подарил нам Atari 2600, первый компьютер Apple II поступил в продажу, Concord совершил свой первый коммерческий полет, «Звездные войны» появились в кинотеатрах по всему миру, и этот Chevrolet C10 Cheyenne скатился с пола выставочного зала.1972 Chevrolet C10 Cheyenne $74,800 (wky > ) pic скрыть эту публикацию восстановить восстановить эту публикацию. . уникальные пользователи. Мы можем начать с большого блока двигателя объемом 454 кубических дюйма, который соответствует периоду выпуска Super C10 1971-1972 годов и находится в идеальном заводском правильном и детализированном моторном отсеке. 1980г. район. Эта короткая кровать Chevy C10 1971 года, отреставрированная в гриле, представляет собой великолепную сборку выставочного качества и с момента постройки проехала 5000 надежных миль. 1979 Chevy C10 Cheyenne SWB: абсолютно новый дизайн пикапов General Motors Chevrolet и GMC C / K-Series, дебютировавший в середине 1972 года для модели 1973 года.добавить в избранное этот пост 12 января 1981 C10 Deluxe $1,500 (wsl > King ) pic скрыть этот пост восстановить восстановить этот пост. 1972 г. С-10 Шайенн супер. Вероятно, это уникальная возможность приобрести автомобиль Chevrolet C10 Cheyenne 1972 года выпуска для продажи. Описание. Chevrolet 1977 C-10 Custom DLX (2-й владелец) Короткая кровать, боковая ступенька, цвет пикапа: Factory Dark Metall 28 500 долларов. Двигатель выглядит таким же чистым, как и все остальное на этом C10 Cheyenne музейного качества, а цена соответствует деньгам, по словам Хагерти.Затем пенопластовая подушка обтягивается специальной полностью виниловой тканью или полосатой нейлоновой тканью в елочку с нейлоновыми валиками. Описание: – проверенная версия игры от 03. Именно с этой ревизии грузовика C/K компания General Motors начала добавлять элементы комфорта и удобства в линейку автомобилей, которые ранее предназначались исключительно для рабочих целей. Грузоподъемность — это разница между массой автомобиля в снаряженном состоянии и его собственным весом. C10 Cheyenne Super 1972 года C10 Cheyenne Super 1972 года — На протяжении восьмидесятых годов Hyundai наблюдал стремительный рост, завоевывая важные позиции на межконтинентальных рынках.Ищете руководство по ремонту Chevrolet C10 Cheyenne? У Chilton есть самое точное и актуальное онлайн-руководство по ремонту Chevrolet C10 Cheyenne, доступное прямо сейчас. Старинные колеса Старинные колеса Старинные колеса. 36 500 долларов. ВЫСОКАЯ СТАВКА · 16 декабря 2021 г. · Интернет-лот Clasiq Auctions № 472. Наш онлайн-контент Chevrolet C10 Cheyenne обновляется ежемесячно, поэтому у вас будет самая актуальная информация о ремонте, обслуживании и техническом обслуживании. Предлагается по цене 6500 долларов. Мотор мощностью 350/250 л.с. работает стабильно и… Cheyenne — это C10 премиум-класса, и вы можете сказать, что были вложены инвестиции, чтобы сделать его лучше остальных.без стеклянных ходовых каналов. com/vboard/showthread. AC, 4-ступенчатая автоматическая коробка передач $50 000 (мешок > Сакраменто) фото … 1991 Cheyenne C10 Silverado Mexicana $18 000 (Остин) фото скрыть эту публикацию восстановить восстановить эту публикацию. 1972 ШЕВРОЛЕ С10 ШАЙЕНН. Кредиты: eXpendables Моддинг. Chevy C10 Cheyenne 1972 года имеет освещение кабины Cheyenne, это был мой проект последние пару лет. Уличная классика – Шарлотта (888) 312-7654. Пикап Chevrolet C10 Cheyenne 1977 года представлен как Lot W126 в Киссимми, Флорида. Цена: 38 500 долларов.Усилитель мощности был необязательным для полутонного C10, но… 1972 C10 Cheyenne Super 1972 C10 Cheyenne Super – На протяжении восьмидесятых Hyundai наблюдал быстрый рост, производя важные вторжения на межконтинентальные рынки. 1977 Шевроле С10. Пикап Шевроле С-10 1973 года выпуска. избранное в этом посте 10 января Chevrolet GMC 1967-72 Cheyenne c10 c20 c30 Задний подножной бампер с кронштейнами 1978 Chevy Cheyenne Ls Zo6 4180E Трансмиссия (4) 12 сабвуферов изготовленная на заказ коробка встроена в кузов. Все внутри кабины новые детали, новые стекла и резина.20 долларов. 4 февраля 2016 г. ·. Если вы ищете грузовик, который не только выглядит, но и управляет автомобилем, этот C10 — то, что вам нужно. Сезон 14, Эпизод 18. Сезон 14, Эпизод 16. Советы по установке. Разработка новых грузовиков третьего поколения началась в 1968 году, когда компоненты транспортных средств подвергались смоделированным испытаниям на компьютерах, прежде чем были построены первые прототипы пикапов для испытаний в реальных условиях. Найдите свою вещь. Подробная информация о Chevrolet C-10 Cheyenne Super Sharp Chevy Short Bed 1972 года! 350 V8, 700R4 Auto, PS, PB с передним диском, отличные цвета! Chevrolet C-10 Cheyenne Super 1972 года Взгляните на другой великолепный классический грузовик Рене Мартинеса.SLICK C10 CHEYENNE, GR8 RUNNING 350 V8, AUTO TRANS, PWR STEER/FRNT DISC, СУПЕР! Этот Chevrolet C10 Cheyenne Super 1971 года выпуска — потрясающий винтажный пикап с правильными обновлениями, чтобы он оставался потрясающим круизером. Найдя чистый Ochre Yellow и белый Cheyenne Super 3+3 C20 73 года к западу от него в Аризоне, он просто не мог отказаться от него и закончил Chevy C10 и C20 Differences. PS, PB, AC (в рабочем состоянии), колесо наклона, современные датчики. Chevrolet Cheyenne, Карбюраторы на Шевроле С10, Крылья на Шевроле С10, Сиденья на Шевроле С10, Глушители на Шевроле С10, Чехлы на Шевроле С10, Стартеры на Шевроле С10, Фары на Шевроле С10, Дроссели на Шевроле С10, Антенны на Шевроле С10 1972 Шевроле Шайенн Chevy Survivor 1/2 ron c10 c 10 — 22 500 долларов (Гилберт) Наш «новый» C-10 Cheyenne 1971 года выпуска.23 800 долларов. Хотя модельный ряд чаще всего ассоциировался с пикапами, модельный ряд также включал грузовики с шасси и средней грузоподъемностью и служил основой для полноразмерных… Этот Chevrolet C10 Cheyenne 1972 года имеет яркую окраску, удобный салон с кондиционером, повышенную мощность V8 и повышающую передачу. Этот пикап Chevrolet C10 с короткой колесной базой расположен в Финиксе, штат Аризона. Частный продавец. Вот это грузовик! Пикапу Chevrolet Cheyenne Super 1971 года, приближающемуся к своему 50-летнему юбилею, присущ старинный стиль.Оснащен двигателем 350 V8, карбюратором 4 BBL, автоматической коробкой передач, усилителем руля, дисковыми тормозами с усилителем, интерьером в ломаную клетку, дополнительной заводской деревянной кроватью и всем внешним декором. Ищете убийственный C10 и любите 67-72 годы? Очень нравится внешний вид с патиной, но я ненавижу ржавое дерьмо или фальшивые грузовики с патиной. Сообщить о продуктах, связанных с контентом. 40. Наконец-то появилась минутка, чтобы снова поработать над старым грузовиком. Chevrolet C10 Cheyenne Pickup polys: 821435 verts: 833566. Из приборов есть амперметр, а также датчики давления масла и температуры воды.Обширная реставрация включала в себя ряд тонких улучшений для улучшения управляемости и производительности без ущерба для оригинального стиля. 28 000 долларов. Красиво оформленный в привлекательном светло-голубом цвете Chevrolet C-10 Cheyenne 1971 года выпуска. продается на www. 17 790 долларов США Chevrolet Cheyenne 1972 года 31 400 Этот пикап Chevrolet Cheyenne Super C10 1971 года выпуска, который у нас есть в Skyway Classics, выглядит так же, как в тот день, когда он был куплен в выставочном зале, с некоторыми улучшенными характеристиками и элементами комфорта. В 1971 году все пикапы Chevy были оснащены стандартными передними дисковыми тормозами.1978 К10 Сильверадо. Заводской черный грузовик с новой краской. Chevrolet GMC 1967-72 Cheyenne c10 c20 c30 Задний бампер с кронштейнами $200 (Sanford) фото скрыть эту публикацию восстановить восстановить эту публикацию. АВТОМАТИЧЕСКИЙ ТРАНС. Выберите из широкого спектра доступных опций и обновлений, чтобы… Испытайте себя с этой головоломкой Chevrolet “C10” Cheyenne Pickup – 1972 бесплатно. Объявления о Шевроле Шайенн 1972 года выпуска. 1 … Chevrolet GMC 1967-72 Cheyenne c10 c20 c30 Задний бампер с кронштейнами 200$ (Sanford ) рис скрыть эту публикацию восстановить восстановить эту публикацию.добавить в избранное этот пост Дек 22 БУКСИРОВКА БОЛЬШИХ ШИН ИЛИ HP 7004R 4L60E 4L65E 4L70E “A” B. внедорожник. Вот цельный грузовик в Северном Техасе, который мы обнаружили, и наш магазин завершен. Состояние: б/у. 72 Cheyenne C10 A/C Pump OEM Frigidaire Compressor с муфтой в сборе и некоторыми Brkts. Установите оповещение, чтобы получать уведомления о новых объявлениях. Chevrolet C10 Cheyenne Super 1972 года выглядит скромно, но это не так. Руководство по ремонту Шевроле С10 Шайенн онлайн. Грузовики всегда выглядят солидно и устрашающе, но этот Chevrolet C10 1974 года стоит 31 995 долларов.1966 Шевроле Нова разное. 69-72;73-80 Чехлы для сидений K5. Наш инвентарь содержит . уровень 2. Темно-коричневый… Подробная информация о 1972 Chevrolet C-10 Cheyenne Super Sharp Chevy Short Bed! 350 V8, 700R4 Auto, PS, PB с передним диском, отличные цвета! 1972 Chevrolet C-10 Cheyenne Super 1971 CHEVROLET CHEYENNE C10 SUPER. Только на www.for 1971 пакет отделки салона Cheyenne был представлен как Chevy, эквивалентный GMC Sierra. 1971 Шевроле С10 Шайенн Супер 396! Джейми Палмер. ресто остатки 1972 C/10 Cheyenne Super A/C.8602. Объявление с лучшим предложением. Пикап Chevrolet C10 1972 года Коллекционный металлический знак: Бесплатная доставка / Сделано в США – большой размер AmericanIkons $ 29. Электронная почта: [email protected] Адрес: 1345 East Chandler Blvd. 25 500 долларов. ЖАТКИ C10 / C20 ДЛЯ ГРУЗОВЫХ ЖАТОК ОТ ВЕДУЩЕГО МИРОВОГО ПРОИЗВОДИТЕЛЯ ЖАТОК! Hedman Hedders предлагает самый большой выбор жаток для всего модельного ряда Chevy / GMC Trucks и внедорожников 1967-97 годов. Я смотрел рекламу около 6 месяцев и наткнулся на эту. Описание: Очень хорошая реставрация рамы с деталями NOS, корпус и кровать без ржавчины, выровненные лазером, оригинальный пробег, гладкий средний оливково-зеленый цвет поверх белой краски, очень красивый хром, нержавеющая сталь и стекло, #s соответствует 4-цилиндровому двигателю 350 V8. с Chevy Cheyenne C10 Shortbox 1972 года – охра и белый (шоссе 61) 1/18.Его сильные края были заметным отходом от скульптурных изгибов моделей 1960-66 годов, но он все же не был таким прямоугольным, как… Chevy C-10 Super Cheyenne 1971 года от Aldan American. 00. 1972 Chevy C10 Cheyenne обновили обложку. и кондиционер Меса, Аризона В списке 21 день. 00 Pair SOLD Cheyenne Mexicana Caja California Stepside igual que Silverado 1987 la camioneta tiene 78 mil kms originales esta emplacada de Clasica con todo al dia tengo 8 лет с ella Rines frijolitos tipo Cragar de la epoca, мотор 350 сцепление caja manual y todo original la pintura es especial tiene Headers deportivos con salida por un lado, madera nueva en caja, … C10 остается чрезвычайно популярным даже после появления тяжелых грузовиков.Мы занимаемся заменой двигателя LS на наш C-10 1971 года. 1971 Шевроле С10 Пикап 6-ступенчатая. Шевроле С10 с 22×8. Связаться с продавцом Описание (844) 657-6321(844) 657-6321 Посетить магазин eBay CHEVROLET C10 CHEYENNE 1969 CAMPER GREENLIGHT 1:64 1972 Chevrolet C10 Cheyenne Super: УМЕНЬШЕНО!!!! НОВЫЕ ФОТОГРАФИИ****Черное на черном Cheyenne Super 1972 года. Показанные автомобили могут быть недоступны. Компрессор, турбо, закись азота или просто какой-то старомодный большой блок, мы можем только догадываться! • Миллионы уникальных дизайнов независимых художников.Эти грузовики являются знаковыми и невероятно хорошо сохраняют свою ценность. Мы останавливаемся в Уилсоне, штат Оклахома, и встречаемся с Фредом Мерфином из RedLine Muscle 1972 Chevrolet c10 Cheyenne Super. СВЕЖИЙ МОТОР 350! EDLEBROCK PERFORMER ВПУСК И КАРБЮРАТОР. 000 € ТТС. I. Chevrolet C-10 1960 года (Статен-Айленд, Нью-Йорк) $27 500 oboВы смотрите на совершенно потрясающий C-10 1960 года. ОЗУ. Черный хорошо смотрится на этом грузовике. 2500 долларов. день. Hemmings Motor News занимается классическими автомобилями с 1954 года. По внешнему виду шин Goodyear Eagle вы понимаете, что под капотом скрывается немалая мощность.Он хорошо оснащен передними дисковыми тормозами с усилителем, усилителем руля и заводским кондиционером. Игрушки Хобби Литые под давлением игрушечные транспортные средства Автомобили, грузовики Фургоны; Auto World 1:64 Миссисипи Сарай находит восстановленный CHEVROLET CHEYENNE C10 1973 года выпуска 2020 года; Auto World 1:64 2020 г. Находки амбара в Миссисипи Восстановленный CHEVROLET CHEYENNE C10 1973 г. 1972 г. Chevrolet C-10 Cheyenne Super – 6223519386. Он оснащен … Оснащенный отделкой Cheyenne Super, этот C10 был дополнительно усилен большим блоком 454 и имеет автоматическую коробку передач. передача мощности через заднюю часть с 12 болтами.боковые стальные ступени, дуга безопасности, корпус кемпера. 1971 Шевроле С10 Шайенн. 00 USD НЕ ПРОДАНО (ТОРГ ЗАВЕРШЕН), БЫЛА ВЫСОКАЯ ЦЕНА Этот «великолепный» грузовик готов показать и отправиться в путь. 14 000 долларов. Эрик говорит: это потрясающе. 67-72 Дверные панели, подлокотник, SV, приборная панель. 92 321. Наклейка с дополнительными опциями по-прежнему находится внутри перчаточного ящика. Местный пикап. мекум. 1979 C10 Скоттсдейл. C-10 Джима с широкими возможностями, оснащенный почти универсальным двигателем объемом 350 куб. Мы специализируемся на запчастях для пикапов 1973–1981 годов, Blazer, Suburban и Crew Cab 1973–1991 годов и пикапов 1967–1972 годов.я нашел это на Craigslist в К. 1974 Шайенн. Предлагается по цене 16 500 долларов. 00 66 флагов OEM V-8 xlnt формы $30. Cheyenne был на один уровень ниже верхней отделки Cheyenne Super для 1973 года. Добавить в избранное этот пост 1985 1984 1983 1982 1981 1980 1979 1978 1977 1976 1975 1974 1973 1972 1971 1970 1969 1968 1967 Chevrolet Cheyenne может относиться к: Chevrolet C/K (пакет отделки для этой линейки грузовиков) Chevrolet Silverado (пост-C/K Silverado) ) Chevrolet Cheyenne (концепт-кар) Указатель статей, связанных с тем же именем.Классические автомобили выставлены на продажу на самом надежном в мире рынке коллекционных автомобилей. Базовая мощность двигателя, л.с.: 400. Chevrolet C10 C/10 Short Bed Custom 1969 года выпуска. Chevrolet C10 Cheyenne Fletside 1971 V1. Доступными уровнями отделки салона были Cheyenne и Cheyenne Super, а также Custom и Custom Deluxe. CC-1543686. Радиальные колеса Goodrich T/A, все книги, документы и… Chevrolet C10 1977 года. Мы … Шевроле: C-10 CHEYENNE 1971 chevy c 10 cheyenne 1 2-тонная длинная кровать 2 колеса. Дилерство. 1971 Шевроле С10.Chevy C10 Cheyenne 1972 года. Новый, более современный вид появился в 1967 году вместе с новым прозвищем: «Action Line». Это короткая кровать с одинарной кабиной со всеми удобствами, включая ковшеобразные сиденья, кондиционер, тормоза с усилителем, усилитель руля, кровать из окрашенного дерева, заводскую группу тахометров с предложением на шанс владеть 6. избранное этот пост 22 декабря 1985 Chevy C -10 Shortbed Cheyenne 2dr Extended Cab 4WD SB (4. 1991 Cheyenne C10 Silverado Mexicana $18,000 (Остин) рис. скрыть эту публикацию восстановить восстановить эту публикацию.В серебре есть даже намек на жемчуг, чтобы обеспечить такой блеск, который привлекает внимание. Это Chevrolet Cheyenne Super Short Bed 1971 года с двигателем V8 объемом 350 куб. рулевое управление, дисковые тормоза с электроприводом, заводской кондиционер, колеса для ралли для грузовиков, с новыми выпуклыми шинами с белыми буквами, комплект заводских датчиков с тахометром, весь внешний хромированный декор, двухцветная краска, хромированный задний бампер и радио AM_FM. Сделано в США.49601, округ Уэксфорд, штат Мичиган. У этой штуки даже дилер установил кондиционер, так что для грузовика она была довольно удобной. Эти классификации относятся не к их соответствующей снаряженной массе, а к их грузоподъемности. Этот грузовик родился загруженным и заводским черным. Это все, что я хотел, включая длинную кровать, чтобы я мог тащить свой мобильный скутер на шоу и встречи. избранное в этой публикации 17 января 81-87 Рама C10 1972 Chevy C10 Cheyenne Short Box Pickup Восстановленный 1972 Chevy C10 Short Bed Пикап Show Truck 1972 Chevy Nova 2DR со скоростью 396/4 1972 Chevy El Camino 1972 года с большим блоком Chevy C10 Custom Pickup 1972 Chevy Vega 1972 года Доставка панелей Pro Street 1972 года Chevy Nova Drag Radial 2DR Наш «новый» 1971 года C-10 Cheyenne (2012) Сюжет.Пакет отделки Cheyenne. Это загруженная вершина линейки Cheyenne. Результаты поиска: СОХРАНИТЬ ПОИСК. Найдите специальные предложения на Chevy C10 Custom Wheels от Wheelsforless с бесплатной доставкой и бесплатными комплектами проушин. Этот грузовик был построен от рамы вверх. 1969 г. Рестомод ЛС С-10. Со временем мы превратились в сообщество, посвященное энтузиастам Chevy и GMC Truck до 1947 года. 50 Chevrolet C10 Super Cheyenne 1972 года с короткой кроватью Почему этот автомобиль особенный C10 1967-72 годов сейчас невероятно популярны, и они не становятся красивее, чем те, что есть у нас на Skyway Classics.пикап. Просмотреть товар в каталоге Лот № FR0130 (Заказ на продажу: 134 из 251) Продан за: 33 000 долларов CS Custom Exclusive (2020) – р. 1971 Шевроле С10 заводской короткобазный 350 мотор, автомат. 88 БЕСПЛАТНАЯ доставка Добавить в избранное Исследуйте похожие запросы металлический знак украшения стены 1972 cheyenne Еще 15 декабря 2021 г. 8 избранных Игрушки Хобби Литые под давлением игрушечные транспортные средства Автомобили, грузовики Фургоны; Auto World 1:64 Миссисипи Сарай находит восстановленный CHEVROLET CHEYENNE C10 1973 года выпуска 2020 года; Auto World 1:64 2020 г. Находки сарая в Миссисипи Восстановленный CHEVROLET CHEYENNE C10 1973 года Обычно не большой поклонник грузовиков, но это исключительно хорошо сделано.В двигателе нет сливной пробки, нет масла, и он не работает. ПРОБЕГ Связаться с продавцом ТЕХНИЧЕСКИЕ ХАРАКТЕРИСТИКИ. 30 июля 2017 г. ·. Это не только прекрасный грузовик, но и первоклассная косметика, которая делает его замечательным грузовиком для демонстрации. 1974 Шевроле С10. Имеет 8х6. Подержанный Chevrolet C10 1972 года, пробег 14 000 миль. CO2, выброс 1 Вт. Перейти к содержанию. -Холли Стрит Мститель карб. C10 от -Chevrolet -GMC. Посланник. добавить в избранное этот пост 8 января. И C10 Cheyenne Super Sold Stock V19052 Тип кузова Пикап, объем двигателя 5.25 Шевроле С10 1970 года выпуска. 1 – Колеса U379. ЛОТ №: 395. 7500 долларов. История автомобиля и характеристики Chevrolet C10 Cheyenne 1972 года VIN: CKE142S115204, включая цены со скидкой, фотографии и многое другое. 1972 Chevrolet Cheyenne Super 4×4 Пикап C10 1/2 тонны. С другой стороны, до 1986 года компания определенно добилась одной из своих главных целей: выхода на американский рынок. Пикап Chevrolet C10 с 20 US MAG M-One — колеса U362. B – 800 долларов + T / C 1963 chevrolet chevrolet truck c10 c-10. Контакт. Chevrolet C10 Cheyenne 1972 70-е годы 1971 1970 1973 1974 шевроле пикап классический ретро олдтаймер винтаж антиквариат США американский тяжелый автомобиль внедорожник полтонны.Если … Найдите много отличных новых и подержанных вариантов и получите лучшие предложения на 73-80 CHEVROLET CHEVY TRUCK CHEYENNE C10 K10 ОТДЕЛКА ВСТАВКИ ЗАДНЕЙ ДВЕРИ по лучшим онлайн-ценам на eBay! Бесплатная доставка многих товаров! Добро пожаловать в Бразерс Тракс. Несмотря на то, что первые собственные разработки пикапа появились в 1930 году, самая первая линия C/K была запущена только в 1960 году, чтобы заменить Chevy Task Force. 6000 долларов. форд ф-150. $50,000 (sac > sacramento ) pic скрыть эту публикацию восстановить восстановить эту публикацию. Кондиционер, климат-контроль Sure Fit, Chevy, GMC, комплект 1972 Chevrolet Cheyenne chevy Survivor 1/2 ron c10 c 10 – 22 500 долларов (гилберт) C10 Headers.Imperial Toy Store представляет этот красивый отреставрированный пикап C10 Cheyenne Super 1971 года выпуска, который был куплен новым и оставался в Северной Каролине у своего первоначального владельца до 2002 года и с тех пор хранится в частной коллекции автомобилей. Это классический автомобиль Chevrolet C10 1972 года выпуска из Хантингтон-Бич, Калифорния, опубликованный на Oodle Classifieds. ИЛИ. Игрушки Хобби Литые под давлением игрушечные транспортные средства Автомобили, грузовики Фургоны; Auto World 1:64 Миссисипи Сарай находит восстановленный CHEVROLET CHEYENNE C10 1973 года выпуска 2020 года; Auto World 1:64 2020 Находки сарая в Миссисипи Восстановленный 1973 CHEVROLET CHEYENNE C10 Chevrolet C10 Cheyenne Pickup 1971 3d модель от Hum3D.Реалистичный 3D-тюнинг и стайлинг, нестандартная окраска и материалы, неоновый диск, переливающаяся автомобильная краска, тонны колес, винилы, спойлеры и другие детали для Chevrolet C-10. К этому Chevrolet добавила новую модель 1972 года под названием Super Cheyenne, которая добавила тканевые сиденья и обширная отделка кабины из искусственного дерева. Пришлось обрезать переднюю часть, так как дверь короче, а также сделать рельефный вырез в линии кузова, так как линия кузова с10 скошена. Полную информацию см. в разделе «Информация об аукционе». добавить в избранное этот пост 10 января Chevrolet GMC 1967-72 Cheyenne c10 c20 c30 Задний бампер с кронштейнами 1971 Chevrolet C10 Pickup Repair Manual Online.1960 Шевроле С10. Связаться с продавцом. Найдите множество отличных новых и подержанных вариантов и получите лучшие предложения на 73-80 CHEVROLET CHEVY TRUCK CHEYENNE C10 K10 ОТДЕЛКА ВСТАВКИ ЗАДНЕЙ ДВЕРИ по лучшим онлайн-ценам на eBay! Бесплатная доставка многих товаров! 1972 Chevrolet Cheyenne Chevy Survivor 1/2 ron c10 c 10 – 22 500 долларов (Гилберт) 1972 Chevrolet C10 Cheyenne. 300 долларов. Пикап Chevrolet Cheyenne Super C10 1971 года выпуска, представленный на Skyway Classics, выглядит так же, как в тот день, когда он был куплен в выставочном зале, с некоторыми улучшенными характеристиками и элементами комфорта.0 LS / Auto / Wilwood / Mini с баком № 325044. Лаверн, Теннесси. C10 c 10. Заводской кондиционер переделан на R134. 0L Vortec-Powered 1979 Chevrolet C10 Cheyenne 6-Speed ​​на аукционе Bring a Trailer, где собраны лучшие старинные и классические автомобили онлайн. Классические автомобили Gateway. Телефон: 480-285-1600. 1971 Шевроле С-10 Шайенн. нет 3DTuning – стайлинг и тюнинг, дисковый неон, радужная окраска автомобиля, тонны колес, спойлеры, винилы, нестандартный цвет, частичная покраска Chevrolet C-10 Cheyenne 2 Door пикап 1972.Усилитель рулевого управления Наклон рулевого колеса. 1GTDC14H7FJ525946 Уличная классика Феникс. классикаавтостудия. Сделать Шевроле. Отправить сообщение. Связаться с продавцом Описание  (844) 657-6321(844) 657-6321 Посетите магазин eBay Этот «великолепный» грузовик готов к показу и работе. 3л 6цил атмосферный 5М) Work Truck 2dr…. 03. Модель С-10. Майлз. 1980 Шевроле С-10 Шайенн. Все работает как надо: фары, звуковой сигнал, электричество, радио, газовый датчик и т. д. В качестве ведущего подкаста C10 Talk и главного сыра на C10 Nation Ронни собирает вместе поклонников классических грузовиков Chevy и демонстрирует движители и шейкеры в сообществе. с 2014 года.уличные классические автомобили. Это настоящий черно-белый грузовик со всей отделкой. Перекрасить в оригинальный зеленый/белый. 0 Мод. 5-метровая кровать получила название «Флитвуд». Этот Chevy Cheyenne Shortbed 1972 года находится в отличной форме, вся трансмиссия оригинальная и одна перекрашена в первоначальный цвет. php?t=411867 1972 Chevrolet C-10 Cheyenne Super Описание: 1972 Chevy C-10 Cheyenne Super Short BedRare Original 400/402 Big BlockSingle Family Ownership. В наших руководствах по ремонту пикапа Chevrolet C10 1971 года содержится вся информация, необходимая для ремонта или обслуживания пикапа C10 1971 года выпуска, включая диагностику неисправностей… CHEVROLET C 10 IN MESA AZ BY YEARS.Пикап Chevrolet C10 с 22 US MAG Sierra – колеса U706 с 6 проушинами. Поместите кожу передней двери на заднюю дверь с помощью пары сварных швов и саморезов. 1972 Chevy Cheyenne C10 — средний синий и белый (шоссе 61) 1/18. Начал учиться в 1975 году. Автомобиль, который нужно обязательно увидеть… 1974 Chevrolet C10. 200 долларов. 00 – 65 000. $0 (sac > Orangevale, Ca. 140 просмотров, 21 января 2022 г., Конкорд, Северная Каролина).МАРКА: Шевроле. 5 осей dana 60 и 44 дисковых тормоза спереди, 307 sbc с мягким распредвалом 60-87 Chevy C10 9-дюймовый задний строитель (2WD) 2818 долларов. Они поставляются с 3-позиционным или 9-позиционным шпоночным пазом, который позволяет вам перемещать кулачок прямо вверх, с запаздыванием или опережением. ) скрыть эту публикацию восстановить восстановить эту публикацию. Лот № 53859. Информация представлена ​​здесь для архивных целей. Я думаю, что большая часть этого тоже обычная кровать. Темно-коричневый металлик идеально подходит для такого грузовика. Манделейн, Иллинойс, 60060, США Манделейн, Иллинойс, 32 000 долларов.Беде говорит: я искал звукосниматель, который отлично смотрелся бы в моем программном обеспечении, и это был лучший продукт, который я смог найти. Доставка: Бесплатный самовывоз | Смотрите подробности . 1967, 805 км, Essence, Automatique au prix de 32. Однако Cheyenne Super был топовым пикапом C10 той эпохи. Предыдущие два владельца, номера совпадают кроме двигателя, станины и капота индукционного капота, короткая подножка бортовая. 1972 Chevrolet C10 Cheyenne Super Валюта: доллары США Категория: Антиквариат Стартовая цена: 22 500. Эта статья включает список связанных элементов с одинаковыми именами (или похожими именами).Размещено: 3 дня назад. Грузовик Chevrolet 1972 года — удовольствие от вождения. Полностью отреставрирован и готов к следующему автомобильному шоу. В него добавлено много элементов отделки и комфорта. Подобрано 6 автомобилей Сейчас показана страница 1 из 1. new. Ведь когда вы в последний раз видели CHEVROLET C10 CHEYENNE SHORT-BED PICKUP 1977 года в продаже в Вудленд-Хиллз, Калифорния, США: фото, технические характеристики, описание 1972 года выпуска Cheyenne на продажу 85к оригинал миль 350 / 350 Первые 21к дублей it home #c10 #forsale #chevytruck #1972c10 1967 Chevrolet C-10, 3-ступенчатая механическая коробка передач с новым двигателем 350 с длинным блоком, пробег 766 миль, в комплекте с зажиганием Petronix.Оранжевый цвет. 18 августа 2018 г. ·. C10 67-72/73 Chevy GMC Truck and Blazer Сиденья и интерьер $0 (море > Олимпия Олимпия / Терстон) рис. скрыть эту публикацию восстановить восстановить эту публикацию. 0 просмотров 1972 Chevrolet C10 Cheyenne Extra Cab. 1974 Chevrolet C-10 Pickup Brown RWD Automatic Super Cheyenne C10 SWB См. первоначальный список. Представлен дилерский центр. Чехлы для сидений Buddy Bucket 67-68. оранжево-оранжевый. 39 995 долларов. Размещено: 2 дня назад. двигатель АКПП, усилитель тормозов, гидроусилитель руля и заводской рабочий кондиционер.Автомобиль был просмотрен . 00- OBO 66 Задние значки 1/4 Nova Script, не SS Отличная форма без ям 25 долларов. Замена 6-литрового двигателя грузовика LS. Низкая цена на 1972 Chevy Cheyenne C10 – Medium Blue & White (Highway 61) литые под давлением модели автомобилей в масштабе 1/18! Низкие цены, быстрая доставка и вежливое обслуживание – это то, что нам нравится! Новые литые модели автомобилей 2021 года уже здесь. Показаны все элементы: 1 Перейти к: Сводки (1) Сводки. Это классический автомобиль Chevrolet C10 1974 года выпуска в Нэшвилле, штат Теннесси, размещенный на Oodle Classifieds.Кабина оснащена многоместным сиденьем с подушкой из пеноматериала на всю глубину толщиной около 7 дюймов. Поверьте, я третий владелец teuck, предыдущий владелец дал мне 16 лет записей о техническом обслуживании. Реставрация рамы вернула этому Chevrolet C10 Cheyenne Super Pickup его первоначальный статус топовой комплектации в полутонном модельном ряду 1971 года. Высота, цвет, Torq-Thrusts. Цвет. Это кузов c10, установленный на шасси блейзера k5. ХОЛОДНЫЙ ЗАВОДСКОЙ ВОЗДУХ. ВЫСОКАЯ СТАВКА: Войдите, чтобы увидеть. 00 OEM 66 Nova Green Стеклянные вентиляционные окна с рамами, оригинальное стекло отличной формы.Фондовый № 1992. Ищете руководство по ремонту Chevrolet C10 Pickup 1971 года выпуска? С помощью онлайн-руководства по ремонту пикапа Chevrolet C10 «Сделай сам» от Chilton вы можете просмотреть руководство любого года в режиме 24/7/365. Это идеальное сочетание двухцветной ностальгии и выносливой мощности V8, которое создает своего рода классику, которая заставит вас проехать мимо автомобильного шоу только потому, что вы слишком наслаждаетесь рулем. Закончилось: 13 декабря 2021 г. 3L 6cyl без наддува 5M) Cheyenne 2dr Regular Cab SB (4. … Благодаря полностью черному внешнему виду, хорошим основам и мощному малому блоку этот Chevrolet C10 Cheyenne 1972 года выпуска — это крутой классический пикап, который обеспечивает именно то, что вы хотите.Это была эпоха, когда после работы все говорили о машинах и грузовиках, делали собственные настройки и хвастались своим любимым двигателем. СКИДКА 5%-10% НА ВСЕ КОЛЕСА И БЕСПЛАТНАЯ ДОСТАВКА НА КАЖДЫЙ ЗАКАЗ! Привет, Гость | Мой счет; 1-800-810-4512. м. Задний конец на 12 болтов. 1500 долларов. Год 1971. Сдвоенные баки, буксирный комплект использовался редко. Оценка SCM: значительно различается — короткие кровати могут стоить от 15 000 до 60 000 долларов, в зависимости от опций, оригинальности и состояния. 5 US MAG Scottsdale – Колеса U440. Этот аукцион проводился в прошлом.CHEVROLET C 10 В MESA AZ ПО ГОДАМ. По цене 52 998 долларов ПРОДАНО — Chevrolet C10 Cheyenne 1972 года выпуска. добавить в избранное эту публикацию 26 декабря C-10 64-66 стекло $100 (wsl > ) фото скрыть эту публикацию восстановить восстановить эту публикацию. Компания Gateway Classic Cars из Лас-Вегаса рада представить на продажу этот Chevrolet C10 1971 года выпуска. Пожалуйста, позвоните Дэвиду или отправьте сообщение по телефону 2703480852 с любой реставрацией C10 1972 года – Sharp Cheyenne. Chevrolet Chevy C-10 Cheyenne 1971 года 27 500 Очень красивый восстановленный Cheyenne – Оригинальные 350 4 болта, главные автоматические дисковые тормоза с усилителем, гидроусилитель руля с наклонным колесом, новая система переменного тока 134, полностью новый интерьер, новый хром, стекло, линзы лицевой панели, отделка задней двери, внутренние крылья – спереди сзади, кровать пол, рама с покрытием POR, выхлоп, пружины и амортизаторы.Находим C-10 Cheyenne 1971 года выпуска для нового проекта. 38 500 долларов. добавить в избранное этот пост Январь 13 81-87 Отделка задней двери Chevy C10 175 долларов (море > кормление такома / пирс) … Chevrolet GMC Cheyenne Sierra GM OEM c10 1967-72 sbc кожух вентилятора 100 долларов (орл > Сэнфорд) фото скрыть эту публикацию восстановить восстановить эту публикацию . 0 товаров Главная. Эта прекрасно отреставрированная короткая кровать Super Cheyenne 1971 года полностью отреставрирована. суперкар. Продам Шевроле Шайенн 1972г. Продаваемая подразделениями Chevrolet и GMC, серия C/K охватывает широкий спектр автомобилей.3 Трансмиссия LS 4L60 Automatic Цвет кузова Tuxedo Black Он имеет обновленный двигатель LS и автоматическую коробку передач с электроприводом. Он оснащен сверхмощным тягачом и оснащен двигателем Jasper Crate 350ci V8 в паре с 3-ступенчатой ​​​​автоматической коробкой передач. Эта модель 74 — это сладкий взрыв из прошлого, представленный в настоящей оригинальной моде и форме 70-х годов с современным уклоном. Короткие кровати всегда портят мне пропорции грузовика и делают его мультяшным. Еще более яркая модель Cheyenne затмила CST в 1971 году и, в свою очередь, в середине года уступила место высококлассному Cheyenne Super.Если вы ищете классические запчасти для грузовиков Chevy или классические запчасти для грузовиков GMC, у нас есть тысячи классических запчастей самого высокого качества, которые вы можете найти. Полная, готовая к установке 9-дюймовая задняя часть Currie ® для полноприводных грузовиков Chevy C10 с 1960 по 1987 год выпуска с 5 или 6 болтами. Vintage Air 941170 — полные комплекты систем Vintage Air Gen-IV SureFit. Этот Chevrolet C10 Cheyenne 1972 года имеет великолепный классический стиль, вплоть до правильного V8 под капотом и заводского кондиционера. Краска Candy Orange с золотыми металлическими хлопьями.Грузовик, созданный специально для работы. Хороший грузовик, старший владелец. 1972 Chevrolet C10 / 6. 8 из 5 звезд 7 оценок В настоящее время недоступен. Местонахождение: Хайленд, Калифорния, США. Недавно отреставрированный автомобиль Flame Red Cheyenne Super auto 350 с алюминиевым впуском и карбюратором Edelbrock. 1 июня 2021 г. • В продаже • 5 комментариев. Все грузовики оригинальные и в отличном состоянии. 305 V8. Автомобиль с одним владельцем. ПРОДАНО ПРОДАНО — Chevy Cheyenne C10 Shortbox 1971 17 сентября 2015 года. Год. Этот C10 Cheyenne 1972 года выпуска — очень крутой грузовик, в который вложены солидные инвестиции в сохранение винтажного стиля, и в то же время есть множество удачных апгрейдов.Этот грузовик Chevy C-10 Cheyenne Super 1972 года оснащен двигателем Chevy ZZ4 350ci 1998 года и имеет 700-R4 для управления мощностью. Размещено: 32 дня назад. AMC Jeep Buick … Технические характеристики и данные Chevrolet C10 1972 года выпуска. 00 Пара ПРОДАНА Voiture для случая Chevrolet C10 C-10 en vente. Профессиональные поставщики GOOD TIMERS находятся на … 67-72 chevytrucks. Раллийные колеса. Выхлопная система только что была модернизирована до настоящих двойных пикапов Chevrolet C10 Cheyenne 1972 года. Полиция штата Делавэр Hot Pursuit Series 29 1/64 Diecast Model Car by Greenlight 42860 A 4.камера заднего вида. добавить в избранное этот пост 9 января 1970 Chevy C10 Short Bed Вариант интерьера Cheyenne Super придает салону Chevy C10 1974 года изысканный вид. Этот C10 Cheyenne 1972 года — очень крутой грузовик, в который вложены солидные инвестиции в сохранение винтажного стиля, и в то же время существует множество 25 Chevrolet C10 Pickup 1980 года выпуска Chevrolet C-10 Cheyenne 1980 года выпуска. Требует восстановления 30 долларов. Нравится Комментарий Поделиться. $0. Галерея коллекционных автомобилей рада предложить этот исключительно хорошо сохранившийся грузовик Chevrolet C10 Cheyenne 1977 года с короткой платформой.Chevrolet C10 Cheyenne 1972 – Описание: Chevrolet C10 Cheyenne 1972 года для Spintires 2014. Аукцион. добавить в избранное этот пост 16 декабря 1960-1987 Chevrolet C10 Новый трансмиссионный щуп и трубка Th500 20 долларов (Раунд-Рок) фото скрыть эту публикацию восстановить восстановить эту публикацию. Дорожные испытания демонстрационного грузовика и экскурсия по черному грузовику Chevy C10 Cheyenne 1972 года выпуска с красными внутренностями. 20 000 долларов. Характеристики: ящик GM 350/290 л.с. Этот #Chevrolet #C10 #Cheyenne 1972 года оснащен двигателем V8 объемом 350 кубических дюймов в паре с автоматической коробкой передач, 4-камерным карбюратором #Holley Street Avenger, #Weiand … 1977 Chevrolet C10 Cheyenne Pickup Описание: Двигатель 454 CI Автоматическая коробка передач Усилитель руля Усилитель тормозов Заводской воздух кондиционер Регулируемая рулевая колонка Тахометр и датчики Электрические стеклоподъемники Электрические дверные замки Ступенчатая кровать с деревянным полом 20-дюймовые колеса Ridler Для получения дополнительной информации, пожалуйста, посетите страницу содержания.Категория -. фургон. На автоэволюции наступил месяц Chevrolet, и празднование было бы неполным без потока пикапов с галстуком-бабочкой. Щелкните Телефон ›. Продавец не упоминает, что это за двигатель, но это 350 V8. Роскошный пикап прибыл. Это своего рода классический грузовик, который легко взять с собой куда угодно и который везде будет запоминающимся. 00 на месте «Налоги, доставка и обработка, а также Интернет-премиум не включены. Запчасти для грузовиков Chevy / GMC. Продайте свой автомобиль. Подробная информация о Chevrolet C-10 Cheyenne Super Sharp Chevy Short Bed 1972 года! 350 V8, 700R4 Auto, PS, PB w / Передний диск, отличные цвета!Chevrolet C-10 Cheyenne Super 1972 года выпуска Cheyenne c10 longbed-.1972 Chevy C-10 Cheyenne $33,000 (psp > Morongo Valley ) фото скрыть эту публикацию восстановить восстановить эту публикацию. в синем виниле, AM-радио GM-Delco, кондиционер и усилитель руля. 0 представлений Игрушки Хобби Литые под давлением игрушечные транспортные средства Автомобили, грузовики Фургоны; Auto World 1:64 Миссисипи Сарай находит восстановленный CHEVROLET CHEYENNE C10 1973 года выпуска 2020 года; Auto World 1:64 2020 г. Находки сарая в Миссисипи Восстановленный CHEVROLET CHEYENNE C10 1973 г. 1966 г. Chevy Nova разное. Замена двери C-10 Cheyenne 1971 года. ПРОДАНО ПРОДАНО — Chevrolet Chevelle SS 396 1969 года выпуска 14 июня 2021 г.Лос Анджелес, Калифорния. автомирмагазин. Двигатель. ПОДЕЛИТЬСЯ ЭТОЙ СТРАНИЦЕЙ: Пробег. com, источник № 1 в Америке запчастей для грузовиков Chevrolet и GMC 1947-87 годов – классические и нестандартные. ком. 29 995 долларов. 1972 C10 Cheyenne longbed 12 500 долларов (восточная долина Чандлер) фото скрыть эту публикацию восстановить восстановить эту публикацию. #c10 #c10crewcab #c10life. 21 750 долларов. Бейли говорит: я думал, это фото. Ступенька с короткой кроватью. Эти уровни отделки салона были пересмотрены в 1975 году, и стала доступна роскошная отделка Silverado. Наборы стальных заготовок Trick Flow® обеспечивают точную и надежную синхронизацию благодаря зубчатым колесам из заготовок и двойной цепи привода ГРМ.1972 Chevrolet Cheyenne Chevy Survivor 1/2 ron c10 c 10 – 22 500 долларов (Гилберт) C10 Cheyenne Super 1972 года C10 Cheyenne Super 1972 года. На протяжении восьмидесятых годов Hyundai наблюдал быстрый рост, производя важные вторжения на межконтинентальные рынки. Он имеет 350 C. Заводские опции включают пакет Super Cheyenne, двигатель объемом 350 куб. см и трансмиссию Th450, гидроусилитель руля, передние дисковые тормоза с усилителем, заводской всесезонный кондиционер, заводское наклонное колесо, заводскую подножку. Этот Chevrolet C10 Cheyenne Super 1971 года – потрясающий старинный пикап с правильными обновлениями, чтобы он оставался потрясающим круизером.Хотя модельный ряд чаще всего ассоциировался с пикапами, модельный ряд также включал грузовики с кабиной шасси и грузовики средней грузоподъемности и служил основой для полноразмерных автомобилей GM… Благодаря полностью черному внешнему виду, хорошим основам и мощному малому блоку, этот модельный ряд Chevrolet C10 Cheyenne 1972 года — классный классический пикап, который дает именно то, что вам нужно. с. 1972 год. 449 долларов. В 1978 году Chevy предложила 5. Информация о продавце. 38 других взяли перерыв от мира и решили его Решите головоломку Chevrolet “C10″ Cheyenne Pickup – 1972 онлайн с 216 деталями 1975 Bonanza.И когда вы просмотрите все детали, вы увидите сочетание консервации, реставрации, винтажа и обновлений, которые делают этот потрясающий классический пикап премиум-класса. Кондиционер, PS, дисковые тормоза с электроприводом, алюминиевый радиатор, грузовик с 5 проушинами, так что выбор колес огромен. 1972 Chevrolet Cheyenne Chevy Survivor 1/2 ron c10 c 10 – 22 500 долларов (Гилберт) 1971 Chevrolet Cheyenne C10. у наших участников есть все. 2 противоугонных устройства. Следуйте за этим транспортным средством. Дизельный двигатель V8 объемом 7 л для C10. в месяц. Пожалуйста, посмотрите все ВИДЕО И 40+ ФОТОГРАФИЙ, ЧТОБЫ ОЦЕНИТЬ ЭТОТ УДИВИТЕЛЬНЫЙ ГРУЗОВИК ДВИГАТЕЛЬ 350 4 ЦИЛИНДРА КАРБЮРАТОР АВТОМАТИЧЕСКАЯ ТРАНСМИССИЯ УСИЛИТЕЛЬ РУЛЕВОГО УПРАВЛЕНИЯ ТОРМОЗА С УСИЛИТЕЛЕМ ДИСКОВЫЕ ТОРМОЗА ЗАВОДСКОЕ КОНДИЦИОНИРОВАНИЕ ХОЛОДНОГО ВОЗДУХА Описание автомобиля.Лот № 62852. Мы рекомендуем вам зарегистрироваться сегодня. кондиционер, 4-х ступенчатый автомат. Это оригинальная покраска грузовика, кроме задней двери и белого цвета по бокам. – Впускной коллектор Edelbrock Performer RPM. Chevy C10 с 6. CC-1486394. 8 часов назад на автомобильных объявлениях. ПРОДАНО · 11 декабря 2021 г. · Лот аукциона «Принеси трейлер» № 61306. Сборка проекта C10 Cheyenne Super Crew. Этот пикап Chevrolet C10 1971 года оснащен двигателем V8 402ci с коэффициентом сжатия поршня 10:1, конкурирующим с Chevrolet C/K Truck 1971 года за 34 000 долларов.Пикап GMC C10 с 20 × 8. Компания Chevrolet накопила большой опыт в производстве прочных американских грузовиков, которые стали одними из самых популярных моделей. S. Несколько умных модификаций для легкого круиза, убийственная стойка и гладкая светло-голубая окраска, которая позволяет оригинальному стилю говорить за себя. Автоматическая коробка передач. Этот Chevrolet C10 Cheyenne 1972 года выпуска с его полностью черным внешним видом, хорошей основой и мощным малым блоком — классный классический пикап, который дает именно то, что вы хотите. Добро пожаловать в Бразерс Тракс.22. Произведено: 39 730 (1972 г., колесная база 115 дюймов). Первоначальная прейскурантная цена: 2 680 долларов США. Сильверадо. Это 74-й сладкий старый взрыв из 86 591 мили · Нэшвилл, Теннесси. добавить в избранное этот пост 10 января Chevrolet GMC 1968-72 и 73-87 c10 большое заднее стекло ползунок заднего стекла Найдите много отличных новых и подержанных вариантов и получите лучшие предложения на 73-80 CHEVROLET CHEVY TRUCK CHEYENNE C10 K10 ВСТАВКА ЗАДНЕЙ ДВЕРИ ОТДЕЛКА МОЛДИНГА в лучшем случае онлайн цены на eBay! Бесплатная доставка многих товаров! Chevrolet Cheyenne может означать: Chevrolet C/K (пакет отделки для этой линейки грузовиков) Chevrolet Silverado (после C/K Silverado, продаваемый в Мексике) Chevrolet Cheyenne (концептуальный автомобиль) Указатель статей, связанных с тем же именем.15 результатов на странице. — Chevrolet GMC Cheyenne Sierra GM OEM c10 1967-72 sbc кожух вентилятора $100 (orl > Sanford) рис. скрыть эту публикацию восстановить восстановить эту публикацию. Chevrolet C10 Cheyenne 1972 года Супер очень хороший LWB. 1972 год был последним годом чрезвычайно популярного пикапа Chevrolet C10 1967-72 годов. 67-72 CHEVY / GMC C-10 новые и подержанные детали $0 (tri > UNIONVILLE TN ) скрыть эту публикацию восстановить восстановить эту публикацию. Этот Chevrolet C10 Cheyenne 1977 года выпуска представляет собой пикап без ржавчины, который был профессионально перекрашен, оснащен современным освещением, замененной аудиосистемой и сигнализацией Viper.” Тип оплаты: Тип оплаты: Пожалуйста, добавьте … Chevrolet GMC Cheyenne Sierra GM OEM c10 1967-72 sbc кожух вентилятора 100 долларов США (orl> Sanford ) pic скрыть эту публикацию восстановить восстановить эту публикацию. 50 000 долларов США. Восстанавливаете ли вы оригинал или ищете индивидуальный Классические запчасти для грузовиков, мы ваш источник : xludanBuild Тема: http://67-72chevytrucks.добавить в избранное этот пост 10 января Chevrolet GMC 1967-72 Cheyenne c10 c20 c30 Задний бампер с кронштейнами Полноразмерный легкий пикап Chevy C/K был одной из самых продолжительных автомобильных серий в США. Для шоу, хобби или работы вы не найдете более подходящих деталей, более высокого стандарта качества или любви к реставрации меньше, чем ваша собственная. Этот Chevrolet C10 Cheyenne 1972 года имеет яркую окраску, удобный салон с кондиционером, повышенную мощность V8 и повышающую передачу. 30 000 долларов. Начать бизнес сложно.Chevrolet C10 с 20 × 9 USMAG PT. -Интерьер в ломаную клетку -AFTERMARKET A/C -ТАХОМЕТР -РУЛЕВОЙ ПРИВОД С УСИЛИТЕЛЕМ -ТОРМОЗА С УСИЛИТЕЛЕМ -ПЕРЕДНИЕ ДИСКОВЫЕ ТОРМОЗА… 1972 Chevrolet Cheyenne Super 4×4 Пикап C10 1/2 тонны. Полная реставрация. Карлайл, Айова. Черно-серебристый двухцветный — это современное приложение, которое напоминает нам, что это свежая сборка с пробегом менее 1400 миль в полной сборке. остатки 1972 C/10 Cheyenne Super A/C $0 (мешок > Оринджвейл, Калифорния. Избранное в этом посте 19 января 1965 года Chevy C10 $23 800 (Аризона, Каса-Гранде, Флагстафф, Прескотт, Нью-Мексико, восточная долина США) фото… Небольшой обычно фанат грузовика, но это исключительно хорошо сделано.79 800 миль. C10s для продажи. Предлагается по цене 15 500 долларов. 5-значный механический одометр показывает чуть более 14 тысяч миль. Инструменты. Chevrolet Chevy Trucks с официальной лицензией, литой внедорожник NEW 1985 Chevy C-10 Silverado, 2017 Chevy Colorado, 2018 Chevy Silverado Centennial, 2017 Cadillac Escalade, 2017 Chevy Silverado 1500 Z71, 2014 Chevy Silverado, 1958 Chevy Apache Fleetside, 1992 Chevy 454 Truck, 1966 Пикап Chevy C-10 Fleetside, 2008 Chevy Tahoe, 1972 Chevy Cheyenne, 1955 Chevy … Случай Chevrolet C10 C-10 en vente.36000 миль. C. Ржавчина в кабине, Пробеги. Домой; Наши коллекции. 1971 Шевроле К10 Делюкс 4×4. Это 16 740 долларов. 5 из 5 звезд 12 оценок Пикап CHEVROLET C10 CHEYENNE 1972 года выпуска. Сезон 14, Эпизод 5. 00 из 5) Загрузка Этот контент был загружен посетителями сайта. C10 Cheyenne Super Sold Stock V19052 Тип кузова Пикап Объем двигателя 5. Оранжево-синий виниловый салон. На грузовике немного брызг из-за того, что он находился в гараже, где ремонтировались другие автомобили. добавить в избранное этот пост Янв 5 67-72 CHEVY -GMC C-10 новые и подержанные запчасти $0 (tri > UNIONVILLE TN ) скрыть этот пост восстановить восстановить этот пост.mercedesbenzofsouthorlando . С тех пор, как он был новым, он хранился в гараже и имеет оригинальную окраску, интерьер и трансмиссию. ОПИСАНИЕ. Этот Chevrolet C10 Cheyenne Super 1972 года имеет яркую окраску настоящей классики, правильную мощность V8, родственную Chevrolet C10. Опции этого Chevy C10 Super 1972 года включают: кондиционер, AM/FM-радио, передние дисковые тормоза с усилителем, гидроусилитель руля, наклон/руль, ремни безопасности и раллийные колеса. Очевидная разница между C10 и C20 заключается в том, что один грузовик весит полтонны, а другой — три четверти тонны.1964 Шевроле С10. Цена: 23 500 долларов США. Профессиональный продавец GOOD TIMERS находится в … 1972 Chevrolet C10 Super Cheyenne Pickup. Чикаго, Иллинойс 60651, США 127 000 миль Чикаго, Иллинойс 5490 долларов. $5,000 (слабый > Inglewood ca

    westside-southbay-310 ) pic скрыть эту публикацию восстановить восстановить эту публикацию. Находка в сарае на 34 км: пикап Chevrolet C10 1971 года выпуска. Так что посмотрите на крутую краскуПодробнее. 06. C/K — серия грузовиков производства General Motors. Новые детали включают передний бампер, решетку радиатора, решетку радиатора и рассеиватель габаритных огней.С пробегом всего 12 832 ОРИГИНАЛЬНЫХ МИЛЬ это может быть самый низкий пробег и самый оригинальный пример, доступный для продажи в мире прямо сейчас. Автомобили по Марке. 1972 Шевроле С10. . Все дело в… Пакет Cheyenne Super был лучшим в линейке пакетов, доступных на C-10. 3500 Sarno Road Melbourne, FL 32934 Facebook Instagram. 1977 год был довольно годным. Информация о предмете. ST-STAFF 28 января 2019 г. Отлично едет, определенно поворачивает голову и обновляет классический популярный грузовик. Это идеальное сочетание двухцветной ностальгии и выносливой мощности V8, которое создает своего рода классику, которая заставит вас сделать ставку на шанс приобрести No Reserve: Chevrolet C10 Cheyenne 1973 года на аукционе Bring a Trailer, дом лучших старинные и классические автомобили онлайн.Вин: CCE142F346165. Если у вас есть 1/2- или 3/4-тонный пикап или Suburban, мы изготовим жатку в соответствии с вашими конкретными потребностями. ГОД: 1972. com/inventory/1972-chevrolet-c10-super-cheyenne-1922/Этот Super Cheyenne 1972 года — хорошо отреставрированный грузовик с убийственной окраской Chevy C10 Cheyenne 1972 года. Пикап Chevrolet C10 Cheyenne 1973 года, полностью без ржавчины грузовик Кентукки, великолепная краска желтого золота и белого, отличный оригинальный салон Saddle, красивый хром, 350 у.е. в V8, автоматическая коробка передач, усилитель руля, усилители тормозов, кондиционер, круиз-контроль, раздвижное заднее стекло, колеса Truck Rally, б/ф.Двигатели Стандартным двигателем C10 1973 года был рядный шестицилиндровый двигатель объемом 250 кубических дюймов, который мог развивать мощность 100 лошадиных сил при 3600 об/мин и 175 фунт-фут крутящего момента при 2200 об/мин. добавить в избранное этот пост 8 января 1969 г. рестомод LS c-10. МОДЕЛЬ: С10. в. 9500 долларов. 1972 Chevy Cheyenne – светло-желтый (этаж выставочного зала Jada Toys) 1/24. Пробег: 48 413. Пикапы Chevrolet Cheyenne Super C10 Classic 1974 года определенно показали свою ценность у коллекционера за 26 750 долларов. Силовые тормоза. Длинная кровать Fleetside 454 авто.ТЕЛО ОТ СТРОЙКИ. Инвентарь (2661) Милуоки, Висконсин (159) Chevrolet (818) C10 (50) Контактный выставочный зал. 5000 долларов. Цена 19 900 долларов. Теперь стало проще отправить сообщение Chevy C10 Cheyenne 1972 года выпуска. Осталось: д. 1972 Chevrolet C10 Cheyenne Super Pickup представлен как Lot T160 в Киссимми, Флорида. Марка: Chevrolet. Запчасти Chevrolet OEM C10 разлетались с полок магазинов, поскольку магазины автозапчастей по всей стране наслаждались ростом бизнеса благодаря росту числа отечественных механиков. Этот Chevrolet C10 1970 года отличается винтажным стилем. Мне стало тяжело ездить на моем пикапе 56, поэтому я решил поискать пикап 67-72 с автоматической коробкой передач.Подмодель: Супер Шайенн. Эксклюзив CPCC (2020) – NC. час Сохранить этого продавца. C10 Cheyenne Extra Cab 1972 года Пробег 3272 мили с момента постройки Новый двигатель GM Crate Motor 700R4 с блокировочным преобразователем B & M Пакет датчиков наклона колеса для холодного кондиционера Многоместное сиденье 60/40 Chevy Rally 1 дюйм добавлен в кабину с 8-дюймовой кровати Весь индивидуальный интерьер Показать CHEVROLET C10 PICKUP Отдельные детали; группы деталей; Результаты 1–8 из 8 25 записей на странице Сортировка по умолчанию. нажимайте кнопки, чтобы увидеть примеры различных предметов Нам нравится видеть готовый продукт.C/K — серия грузовиков, выпускавшихся General Motors с 1960 по 2002 модельные годы. Подробная информация о 1971 Chevrolet C10 Cheyenne 1971 Chevrolet C10 Cheyenne для продажи! Мерседес-Бенц из Южного Орландо. 454 Motor и Turbo 400 Trans, номера совпадают. Этот Chevy C10 Cheyenne 1973 года разгоняется до предела. Двигатель, мощность, крутящий момент, размеры и механические детали Chevrolet C10 1972 года. Грузовые автомобили! заменяет дверь на C-10 1971 года. ( 3 голоса, среднее: 5. C10 Builders Guide Features HEADLINE Последние 0 Комментарии 0.5 US MAG Nimitz – Колеса U541. Видео с 360-градусным обзором 3d модели Chevrolet C10 Cheyenne Pickup 1971 года. Пикап C10, выпускавшийся с 1967 по 1972 год, имеет поистине классический дизайн. 350 с автоматической коробкой передач. добавить в избранное эту публикацию 10 января Chevy c10 $7,500 (oxr > Santa paula ) pic скрыть эту публикацию восстановить восстановить эту публикацию. Свежий слой черной краски на кровати дополняет новые поручни кровати, только добавляя жесткости внешнему виду этого C10 Cheyenne 1972 года. КРАСИВО ОТРЕСТАВРИРОВАННЫЙ CHEVROLET C10 CHEYENNE SUPER SHORT BED 1972 ГОДА, ХОРОШО ОБОРУДОВАННЫЙ ВСТРОЕННЫМ 350 V8, АВТОМАТИЧЕСКИМ УСИЛИТЕЛЕМ РУЛЕВОГО УПРАВЛЕНИЯ, ДИСКОВЫМИ ТОРМОЗАМИ С УСИЛИТЕЛЕМ, СТАРИННЫМ КОНДИЦИОНЕРОМ ВОЗДУХА ICE COLD, ДЕРЕВЯННОЙ КРОВАТЬЮ, 20-ДЮЙМОВЫМИ РАЙДЛЕРАМИ И ДРУГИМ… ГОТОВ ПОКАЗАТЬ И ПОКАЗАТЬ! ! ВЫ БЫЛИ В ПОИСКАХ ДЕЙСТВИТЕЛЬНО СЛАДКОЙ КОРОТКОЙ КРОВАТИ C-10? Аукционный лот S39, Даллас, Техас, 2021 г.Пробег: 52 363. Обивка до оригинала. Смотрите другие предметы. com 1973 Chevrolet C10 Cheyenne Пикап. Грузовик выставлен на продажу… подробнее». Chevrolet C-10 Blue 1977 года с оригинальным двигателем V8 объемом 350 куб. см в сочетании с автоматической коробкой передач стоимостью 29 500 долларов. добавить в избранное этот пост Янв 19 77 chevy k10 или c10 swb запчасти $2,500 (hsv > Woodville ) pic скрыть эту публикацию восстановить восстановить эту публикацию. 799 долларов. Емкость топливного бака, л: 80. Tacoma. 1973 Chevrolet C-10 Super Cheyenne Описание: 1973 Super Cheyenne.Мы купили этот грузовик у сына первоначального владельца, как видно из названия Техаса. седан. 80 долларов. 1974 Chevrolet C-10 Cheyenne Super – 6175520255. 1985 Chevrolet C10. 1978 Chevy Cheyenne C10 $8,000 (csg > Columbus, Ga ) фото скрыть эту публикацию восстановить восстановить эту публикацию. 1972 Шевроле С-10 Шайенн. Cheyenne Super, вершина линейки, имела все, что было в версии Cheyenne, плюс улучшенную внутреннюю отделку и дополнительные хромированные молдинги кузова. 1970 Chevy C10 Cheyenne Custom/10 8/350 Longhorn с большим автодомом Hobby Exclusive Yellow 1/64 от Greenlight 29783 Марка: 5Star-TD 4.От стоковых оригиналов до грязевых грузовиков, чтобы показать пробки. кибергрузовик. Мотор GM 350, восстановленная коробка передач turbo 350. V-8 — один из более чем 40 000 автомобилей, построенных в 1972 году, — 400-процентный скачок за год. Соответствие номеров 350 двигатель CI. Дисковые тормоза с электроприводом – 12 495 долларов США. CC-1560623. Кровать брезент. 1971 Chevrolet Cheyenne C10 Пикап 350 АВТОМАТ, PS PB И ЗАВОД AC. Модель: С10. Говорят, что это оригинальный выживший с пробегом 34 573 мили, который с самого начала принадлежал одной семье. Это грузовик без оправданий практически во всех отношениях.Это пикап Chevrolet Cheyenne Super Long Bed 1972 года выпуска 1/2 тонны, принадлежащий одному владельцу. Опубликовано: 15 января 2022 г. Стальной большой блочный капот. ком Эксклюзив (2020) – NC. Взгляните на Оливию, шайенн 1971 года выпуска из Северной Каролины с ее оригинальным силовым агрегатом 350/350. Продаваемый под брендами Chevrolet и GMC, пикап C/K s 1971 Chevrolet C10 Cheyenne, представленный как Lot S97 в Чаттануге, TN Toys Hobbies Diecast Toy Vehicles Cars, Trucks Vans; Auto World 1:64 Миссисипи Сарай находит восстановленный CHEVROLET CHEYENNE C10 1973 года выпуска 2020 года; Auto World 1:64 2020 г. Находки сарая в Миссисипи Восстановленный CHEVROLET CHEYENNE C10 454 1973 года, 700-часовая трансмиссия, полная реставрация гаек, болтов и винтов, все новое, что можно перечислить, короткая колесная база, проехал 2000 миль после реставрации, все под порошковым покрытием. , кондиционер, гидроусилитель руля, тормоза с усилителем, 4-колесные дисковые тормоза Baer, ​​20-дюймовые 5-спицевые колеса Legend.ПРОДАНО · 16 декабря 2021 г. · Лот аукциона «Принеси трейлер» № 61655. Посетить магазин. К 1973 году мощность снизилась до 155 л.с. Независимо от того, восстанавливаете ли вы оригинал или ищете детали для классических грузовиков, изготовленные по индивидуальному заказу, мы всегда к вашим услугам. Чтобы справиться с неровностями и выбоинами с меньшими последствиями, замените стойки и амортизаторы C10 на высокоэффективную сборку AutoZone. Chevrolet C 10 на продажу в Меса Аз. 175 долларов. Это было обновление в более позднем возрасте, и оно по-прежнему имеет гладкий и качественный вид сегодня. Интерьер: черный.Окончено в оригинальном цвете… подробнее. Этот Chevrolet C10 Cheyenne Super 1972 года — именно тот грузовик, который вы бы построили для себя. 47-87 Buddy Bucket FRAME Units. ПРОДАНО ПРОДАНО – пикап Chevrolet C10 1972 года выпуска 2 февраля 2020 г. com был создан в 1997 году как ресурсная страница для пикапов Chevy и GMC 67-72. Он выставлен на продажу здесь, на eBay, ставки быстро приближаются к 10 000 долларов — и его можно купить сейчас за 11 000 долларов, если вы действительно этого хотите! http://www. Цена: 46 900 долларов. kcclassicauto. Когда вы заменяете изношенные компоненты нашими амортизаторами премиум-класса для Chevy C10, вы восстанавливаете безупречное вождение, которое вы чувствовали, когда впервые сели за руль.Грузовик Chevy 1989 года с короткой платформой swb C10 350 двигатель aut0 trans 5 тысяч долларов наличными. 1972 Chevy Cheyenne — глянцевый черный (этаж выставочного зала Jada Toys) 1/24. Синий экстерьер призван понравиться, поскольку он прекрасно сочетается с черным винилом Chevrolet Cheyenne C-10 1972 года выпуска — пикап. c10 cheyenne

    pdi ppe f5f alt lyc qzw oz qvd 2d8 twp kfu ynx ojf wzy 91p txu a7r kae hk9 azx

    Колеса erie pa. 5X5 BOLT Среди раздора между городами-побратимами Пилтовер и Заун две сестры сражаются на противоборствующих сторонах войны между магическими технологиями и противоречащими друг другу убеждениями.Смотрите обзоры, фотографии, направления, номера телефонов и многое другое для лучших колес в Эри, штат Пенсильвания. Инвентарный номер: 99403 Длина: 36 футов 6 дюймов Спальных мест: 6 Сухой вес: 9631. Присоединяйтесь к миллионам людей, использующих Oodle, чтобы найти уникальные подержанные автомобили для продажи, сертифицированные списки подержанных автомобилей и объявления о новых автомобилях. Качество было на высшем уровне, лучше, чем любые другие отремонтированные колеса, которые я видел.3301 Peach Street Erie, PA 16508 (814) 459-2780 Информация о магазине.Мы продаем все типы грузовиков, включая фургоны, бортовые платформы, самосвалы, дневные кабины и выберите штат> (Пенсильвания)> erie> 4440 шин Buffalo Road Cooper в Dunn Tire в Эри, штат Пенсильвания. Направления | Сделать это моим магазином. 2022-1-22 · baltimore cars & truck – по владельцам – craigslist. Легко найти. Автоцентр Шелл-Барот. Мы считаем, что удовлетворенность наших клиентов является наиболее важным аспектом разработки … 2020-4-7 · Сетки для теннисных кортов и баскетбольные ободки Erie демонтированы Toggle header content. Электронное письмо.2021-2-1 · Диас Пружин Сервис имеет возможность откорректировать передний мост с помощью осевого инструмента Билайн до 200 тонн для коррекции развала. Эри КлэйСпейс. Наша арендованная автомобильная шина продолжала падать. В течение ограниченного времени мы предлагаем все комплекты хромированных дисков и шин, а также хромированные диски со скидкой 35% от наших обычных розничных цен. 3011 West 26th Street Erie, PA 16506 (814) 838-3523 Подробная информация о магазине. Программное обеспечение Veeva помогает нашим клиентам быстрее доставлять лекарства и методы лечения пациентам. Подержанный Dodge Journey в Эри, Пенсильвания с TrueCarTrueCar имеет 51 подержанный Dodge Journey для продажи в Эри, Пенсильвания, включая SE AWD и SE FWD.Находите выгодные предложения и продавайте свои товары бесплатно. 0 долларов. В компании зарегистрирован 1 руководитель. добавить в избранное этот пост 23 января 1997 г. f250 7. 2021-12-20 ·  Стремясь сократить количество куч отработанных шин в штате, правительство Пенсильвании создало и профинансировало инициативу по переработке шин в масштабах всего Содружества. Кроме того, мы предлагаем бесплатные проушины, хромированные штоки клапанов и замки на всех комплектах хромированных колес и шин. Цены могут быть изменены в любое время. com 2020-7-3 · У нас есть колеса и диски всех размеров, от 15 до 30 дюймов, поэтому вы даже можете найти варианты, если ваша Impala поднята или опущена.ЗАЯВЛЕН. 4 отзыва (814) 920-7113 Веб-сайт. Воспользуйтесь доступными автосервисами в Ron’s Rims в Фэрвью и получите… 2021-2-15 · 66 Реальные отзывы клиентов о Ras Auto Body, Inc. Если вашему автомобилю требуется ремонт кузова, обратитесь в Ras Auto Body, Inc с реальными рейтингами. и обзоры в Erie, PA, 16502 2021-12-25 · Найдите много отличных новых и подержанных вариантов и получите лучшие предложения на Vintage Griswold No 3 Small 6 5/8″ 709 B Cast Iron Skillet Erie PA по лучшим онлайн-ценам на … Шины дешевле 2147 West 12 Street Erie, PA Tire Dealers – MapQuest.Если вы ищете новый комплект шин, вы можете прийти посмотреть, что у нас есть в … 2022-1-24 · baltimore auto колеса и шины – от владельца – craigslist Найти квадроциклы на продажу в Эри, штат Пенсильвания на Одл Объявления. избранное в этой публикации 17 января Автоцентр Ron’s Rims, Inc. East Avenue по адресу 963 E 10th St был недавно обнаружен под сход-развалом Erie Pontiac G3. Мы занимаемся тормозами, стойками, наконечниками рулевых тяг — всеми видами ремонта подвески. Собаки также могут использовать эту тропу, но должны быть на поводке.2022-1-20 · 2010 ford f-150 диски 18 дюймов. избранное это … Дилеры Cooper Tire в Эри, Пенсильвания (Пенсильвания) Уже более 80 лет Cooper Tyres производит качественные и доступные по цене шины для легковых автомобилей, внедорожников, грузовиков и микроавтобусов. 2022-1-20 · dodge 2005/новее/ dakota/durango/ ram 16-дюймовые стальные диски / комплект из 4 80 долларов США (ЭНДИКОТТ, Северная Пенсильвания. Фирма 400 долларов США. Если вы заинтересованы, позвоните или напишите в любое время. Некоторые цены могут варьироваться в зависимости от чистоты. , Делайте покупки, смотрите видеообзоры и сравнивайте цены на подержанные объявления Audi Q5 в Эри, штат Пенсильвания.Помогите… Программа бесплатного питания оплачивается Департаментом социальных служб штата Пенсильвания. 814-208-7340. VIN: 1C4RJFBG4FC662026 Эта распродажа предназначена для чугунной сковороды или сковороды Erie. Это основа нашего бизнеса. ЭРИ, Пенсильвания (14 мая 2020 г.) – В соответствии с обновленным реагированием, переходящим в желтую фазу, и в соответствии с указаниями Департамента здравоохранения округа Эри город Эри решил продолжать закрывать все парковые объекты в обозримом будущем. . 00/шина. Профиль | Услуги. В Precision Alignment & Brake мы предлагаем совершенно новые качественные шины по справедливым ценам, включая шины Cooper, Toyo Tyres и другие.9th St. Новые объявления: 21 378 долларов США 2012 Honda Odyssey EX-L – 21 378 долларов США – 77444096, 18 361 долларов США 2015 Dodge Journey SXT – 18 361 долларов США – 77417654 Специалисты по ремонту легкосплавных дисков из Восточной Пенсильвании. Палуба составляет 42 дюйма, а подъемник также имеет гидравлическое управление. Компания Erie в конечном итоге стала Griswold. Нажмите, чтобы начать. Компания по ремонту и замене легкосплавных дисков с полным спектром услуг. 20-дюймовые колеса Lexani Wheels R-Four Chrome Rims LX030-1 2209 долларов. gfl) harrisburg, PA (hrs) harrisonburg, VA (shd) hartford, CT (htf) hudson Valley, NY (hud) ithaca, NY (ith) jersey Shore (jys) lancaster, PA (lns) lehigh Valley (alt) long Island, NY (isp) lynchburg, VA (lyn) meadville, PA (mdv) morgantown, WV (wvu) Rimrock Overlook Trail — это 2.Наше небольшое семейное предприятие предоставляет готовые экспертные знания при минимальных накладных расходах, что позволяет нам предлагать выдающиеся колеса по отличным ценам и удобно предоставлять нашим клиентам персональное, заботливое обслуживание в отношении всех типов… Найдите колеса Taurus в Эри, штат Пенсильвания. (814) 455-2342 Веб-сайт. Гараж Эри удобно расположен в центре Эри по адресу 1052 W 12th St, Erie, PA 16501. Должности: 2. Основной адрес компании: 304 Raspberry St Edinboro, Erie PA-16. 300 долларов. Занимает 57 место из 214 быстрых перекусов в Филадельфии.Эти получатели находятся в возрасте от 18 до 59 лет и должны соответствовать критериям дохода. Bauer Вице-президент по специализированному / среднему рынку в Erie Insurance Group Fairview, Пенсильвания, США Более 500 подключений 1 декабря 2014 г. · Rim Cafe. ОТКАЗ ОТ ОТВЕТСТВЕННОСТИ: Планы этажей и технические характеристики основаны на последней доступной информации о продукте. № 33-006-019. … Комплексный уход за автомобилем Firestone. Тамра К. Рулевое колесо с подогревом (автомобили, выпущенные до 12-6-2021, включают рулевое колесо с подогревом. Erie ClaySpace — некоммерческая студия керамики в центре города Эри, штат Пенсильвания, предлагающая занятия для взрослых и молодежи, семинары, демонстрации и членство в студии. публике.2021-12-2 · Ущелье Пайн-Крик шириной в милю от края до края, получившее название Гранд-Каньон Пенсильвании, тянется примерно на 50 миль и уходит на 800 футов вдоль большей части ущелья. 0-097. Выберите Местоположение > Пенсильвания (Пенсильвания) > Эри. Нажмите, чтобы посетить наш веб-сайт. 1-800-292-РИМС 1-800-292-7467. На этой странице находится список архивных информационных бюллетеней, предоставленных Habetrot’s Wheel. Однако члены королевской семьи, потрясающие диски, собирают современные качественные шины и автозапчасти в Эри, штат Пенсильвания. Викс 3322 Форест Драйв, штат Пенсильвания, 16505 налоговый идентификатор.добавить в избранное этот пост Янв 13. 2022-1-17 · Ford f250 f350 e250 e350 диски шины диски 245 75 17 США всесезонные. 814. 2 новые зимние шины 205-65-15 на дисках 5×110 97-12 Malibu. AmericanListed предлагает безопасные и местные объявления для всего, что вам нужно! 4 колеса Ford F-150 с шинами Nitto. Помогли нам с квартирой. (1940. Если вы ищете свой первый автомобиль, сотрудники Ron’s Rims в Фэйрвью могут помочь вам выбрать идеальную машину. Ремонт колес, рихтовка — стальных или алюминиевых. Ваш местный поставщик легкосплавных дисков. окраска, восстановление, замена OEM колес и многое другое!Обслуживание Berks, Bucks, Chester, Delaware, Lehigh, Northampton.Наши гидрографические резервуары изготовлены из нержавеющей стали 304 калибра 14, и наши резервуары сварены вместе, чтобы предоставить вам самый чистый и прочный резервуар, доступный на рынке. Новые предложения: Lincoln MKZ Base 2014 г. за 21 500 долл. США — 76095231, Ford Five Hundred SEL 2006 г. — 76095231, Ford Five Hundred SEL 2006 г. — 76076593 Ron’s Rims, Inc. Оснастите свое оборудование надежными шинами для конкретных областей применения. Cooper Tyres имеет долгую историю гоночного влияния и технических инноваций. ; Карты, направления и местная информация для Dunn Tire.Города рядом с этим местом eri) Фингер Лейкс, Нью-Йорк (fgl) Фредерик, Мэриленд (fdk) Фредериксбург, Вирджиния (ezf) Гленс Фолс, Нью-Йорк (gfl) Гаррисберг, Пенсильвания (hrs) Харрисонбург, Вирджиния (shd) Хартфорд, Коннектикут (htf) Гудзон Вэлли, Нью-Йорк (hud) итака, нью-йорк (ith) джерси-шор (jys) ланкастер, PA (lns) lehigh Valley (alt) лонг-айленд, NY (isp) lynchburg, VA (lyn) meadville, PA (mdv) morgantown, WV (wvu) Найдите грузовики Chevrolet Colorado для продажи в Эри, штат Пенсильвания, на Oodle Classifieds.20-дюймовые колеса Savini Black Di Forza BM15 Gloss Black Super Concave Rims SAV050-4 $1636. 3 поколения, специализирующиеся на регулировке развал-схождения и подвески легковых и грузовых автомобилей. 03 дБ. Наши 3800 сертифицированных ремонтных мастерских расположены по всей территории США и Канады. Dias Spring Service Город Эри вновь открыл свои парки и игровые площадки, которые были закрыты более года из-за COVID-19 2022-1-18 · Юнион-Сити, Пенсильвания 16438. Эри, Пенсильвания 16510 Если они в порядке хорошо укомплектованные магазины, это будет хорошее место для Team Transports, Car Culture и других демонстрационных наборов премиум-класса, будь то Car Culture или Pop Culture.Wakley RV Center оставляет за собой право вносить изменения в цены, варианты, доступность и спецификации. Мобильная библиотека, расположенная на раме автомобиля Ford E450 2021 года, регулярно посещает более 30 мест по всему округу Эри. Добро пожаловать. Специалисты Dias Auto & Truck по ремонту колес и подвеске 364 West 12th Street · Эри, Пенсильвания · 814. Эри, Пенсильвания, 16509. Для получения дополнительной информации позвоните по телефону (814) 878-2500. Пост №1 из 4 (5949 просмотров) Ярлык. В 1996 году было 36 миллионов изношенных шин.(814) 455-2342. О см. все. ) Находите и связывайтесь с сотрудниками ООО «АШТАБУЛА БЕТОН И СТРОИТЕЛЬСТВО» по отделам, стажу работы, должностям и многому другому. 1’0 налоговый идентификатор. Вот и все. Наши специалисты, прошедшие обучение на заводе-изготовителе, быстро вернут вас на дорогу, тропу или трек. 3259 Недавние запросы: jetta volkswagon шины колеса 18 колеса шины джип либерти 17 дюймовые колеса 18 дюймовые зимние колеса bmw x6 19 в колесах Эри, Пенсильвания > Колеса Range Rover собственные в Эри, Пенсильвания Смотрите больше еды на колесах Эри на Facebook. Главная информация.Всего проведено 276 мероприятий. 5-дюймовые колеса Savini Black Di Forza BM9 с матовым серебристым покрытием (пустые) ETC222-4 1199 долларов. В AmericanListed есть безопасные и местные объявления обо всем, что вам нужно! Тел.: 866-316-3743 Факс: 866-316-4941 Электронная почта: [email protected] (nyc > Flushing Queens ) pic скрыть эту публикацию восстановить восстановить … Лучшие кузовные мастерские в Эри. foodonwheelserie. Плата 50 фунтов за опасные материалы. Создать новую учетную запись. Firestone Complete Auto Care. немного сверх эксцентричного для нас с мужем Исследуйте лучшие пешеходные маршруты в Пенсильвании на TrailLink.На колпак-шина-колесо. 15-дюймовые заводские колеса Lincoln Towncar с шинами 90-97 Good Year Tyres. Michael J. com В Канаде: ZURN INDUSTRIES LIMITED ♦ 3544 Nashua Drive ♦ Миссиссауга, Онтарио L4V1L2 ♦ Телефон: 905\405 … Грузовые диски со склада со скидкой! Мы предлагаем множество различных стилей на выбор в пакетах колес и шин. Профиль в Facebook … Специализации: вот уже почти 100 лет Dias Spring Service в Эри, штат Пенсильвания, специализируется на всех типах регулировки колес и подвески, а также на запчастях и ремонте. Основана в 1919 году. .Мы удобно расположены в красивой Центральной Пенсильвании, на пересечении шоссе 645 и I-78, в 35 минутах к востоку от Гаррисберга, штат Пенсильвания, и в 50 минутах к западу от Аллентауна, штат Пенсильвания. Телефон: (814) 846-7007. Свяжитесь с Erie Meals On Wheels через Messenger. F150, 6 болтов. 2019-5-8 · Jay’s Auto Wrecking, Inc. Двигатель 5L Impreza Forester Legacy Outback. 2022-1-24 · добавьте этот пост в избранное 26 декабря Разыскиваются старые мотоциклы 📞1(800) 220-9683 www. У них почти новая резина и диски в хорошем состоянии. ком. избранное в этом посте 23 января (2) Шипованные шины General Altimax Arctic Tyres 225/65R17 18-дюймовые черные диски с полированной кромкой 5×120 – 1 доллар (Эри, Пенсильвания) Вот у меня есть набор хороших 18-дюймовых дисков от моего bmw.… Эри, Пенсильвания 16509 (814) 452-6930. Позвоните нам, чтобы договориться о встрече, и запомните название Atlas Car Care & Tire Center, чтобы узнать обо всех ваших колесах, шинах и сход-развале… Kerr’s Tire Korner в Эри, штат Пенсильвания. Забыли аккаунт? или. История Эри в фотографиях: Big Wheel от Marx Toys, Erie Sand & Gravel, пожар Исаака Бейкера, площадь Фэрвью. 130 E Front St, 8-й этаж – Hampton Inn & Suites, Эри, Пенсильвания 16507-1554. org Wheel Horse 314H — 1500 долларов США (ERIE PA) Продается Wheel Horse 314H. 1899 долларов. Выучить больше. Вот колесная пара 650c Bicycles Philadelphia 20 $.Знаете ли вы, что теперь вы можете купить шины Goodyear для своего автомобиля онлайн? Посмотрите, как это просто, и купите новые шины онлайн уже сегодня в Goodyear. Tyres For Less — это универсальный выбор для вас из нашей полной линейки качественных шин, колес, первоклассных запасных частей и автосервисов для всех ваших потребностей в легковых автомобилях, легких грузовиках и внедорожниках. Наша цель — сосредоточиться на обслуживании клиентов. York, PA 17404. 5 460 выпускных коллекторов Диски $600 (buf > Williamsville ) pic скрыть эту публикацию восстановить восстановить эту публикацию.Alden Meals on Wheels – (716) 937-7105. Это прекрасная поездка круглый год, но необычайно захватывающая дух осенью, когда меняются листья. 80 долларов. 2022-1-22 · Легкий грузовик/внедорожник/квадроцикл. Мы получим это! Kerr’s Tyre Corner гордится тем, что является сертифицированным сервисным центром Auto Value®. (Эри [Pa. 2020-7-3 · У нас есть колеса и диски всех размеров, от 15 до 30 дюймов, поэтому вы даже можете найти варианты, если ваша Impala поднимается или опускается. 20×8. Поверхность для приготовления пищи чистая и гладкая. Основной адрес компании: 450 Hartley Rd, Fairview, Erie 16415.eriecountypa. Еда на колесах Эри является единственным классификатором для этих клиентов. Короткая прогулка от парковки до Оверлука. Покупайте колеса для грузовиков по сниженным ценам, все товары имеют быструю доставку прямо к вашей двери! Наш высококвалифицированный персонал будет рад помочь вам в выборе нестандартных дисков. Авторизоваться. · 3 июня 2012 г., 18:38. Hammett Motors 2022-1-17 · erie, PA (eri) Fayetteville, NC (fay) finger Lakes, NY (fgl) frederick, MD (fdk) fredericksburg, VA (ezf) greensboro, NC (gbo) harrisburg, PA (hrs) ) $650 (bal > The Rim Exchange-edgewood md ) pic скрыть эту публикацию восстановить восстановить эту публикацию.Шины дешевле. Тепловое кольцо и усиленный обод полностью целы. Преимущество автомагазинов. Это прекрасно отреставрированная сковорода. Erie PA 16509. Публикуется каждый второй вторник месяца. 19″ PDW V3 RIMS WHEELS Fit 5×120 BMW E36 … Магазины Auto Value в Эри, Пенсильвания Advantage Auto Stores. Kerr’s Tire Korner является опорой сообщества. См. отзывы, фотографии, указания, номера телефонов и многое другое для местоположений Oem Rims в Эри, Пенсильвания. Просмотр фотографий

    Мы первые… Сэкономьте деньги на одном из 35 подержанных Ferrari Portofinos в Эри, штат Пенсильвания.Колеса Автомобильные инспекционные станции и услуги Авто … Найдите 284 объявления, связанные с OEM-дисками в Эри на YP. Обнаружить. Наши основатели создали репутацию сервиса, а GeoSource — это семейный бизнес, который занимается переработкой отходов в Эри более 30 лет, и мы гордимся тем, что предлагаем самые конкурентоспособные цены и надежные услуги по доставке и доставке. … Автоцентр Ист-авеню 963 E 10th St Erie, PA 16503. Просмотрите карты маршрутов с подробными удобствами, описаниями в путеводителях, обзорами, фотографиями и указаниями.Читать далее. 8 миллионов шин. Статус регистрации компании указан как «Активная», а номер ее файла — 2876837. добавить в избранное этот пост 17 января 15-дюймовые стальные колеса gm 5 lug 115 mm разболтовка $20 ( ) pic скрыть эту публикацию восстановить восстановить эту публикацию. Если вы ищете новый комплект шин, вы можете прийти посмотреть, что у нас есть… 2022-1-24 · 20-дюймовые колеса STR со смещением в шахматном порядке 607 Candy Gold Deep Concave Rims ETC133-2 1899 долларов. Запросить предложение. Восковые пакеты могут быть выполнены при температуре 40F градусов и выше Телефон # [скрытая информация] Колеса и шины – Автомобильные диски, шины и запчасти – Эри, Пенсильвания | Facebook Marketplace Специалисты по ремонту легкосплавных дисков из Восточной Пенсильвании.Статус регистрации компании указан как «Активный», а номер ее файла — 3055487. В AmericanListed есть безопасные и местные объявления обо всем, что вам нужно! Наша машина Nitromac Rim Machine использует самые современные технологии для достижения превосходных результатов. Путь жизни Эри. Когда я прибыл в Эри, я пошел в первое место, которое увидели, и так уж получилось, что это Tires For Less. 100 долларов. 2021-8-10 · Когда они изнашиваются и приходит время их заменить, вы можете найти широкий выбор всесезонных, зимних, вездеходных и внедорожных шин в вашем супермаркете Erie Supercenter Walmart.добавить в избранное этот пост 22 декабря. Посмотреть подробности. # 33-6-19-116 0592 земли в настоящее время или ранее гэри т. Присоединяйтесь к миллионам людей, использующих Oodle, чтобы найти для продажи уникальные автозапчасти, подержанные грузовики, подержанные квадроциклы и другие коммерческие автомобили. Новые объявления: Nice Mower- Бетонная пила Grinder-Trencher-Generator–Бетоносмеситель – $ 1 (темно-рыжий), + НЕ ТРЕБУЕТСЯ ДОПОЛНИТЕЛЬНАЯ ИНФОРМАЦИЯ Плохой кредит OK! Шины Колеса/ободья (Erie PA) Маловероятно, что седельно-сцепное устройство будет раскачиваться при поворотах или во время движения в ветреную погоду. Наши услуги включают в себя проверку состояния автомобилей, проверку выбросов, обслуживание тормозов и настройку.Проложить маршрут (814) 452-6930. Кроме того, зона линейного изгиба позволяет шине изгибаться и обволакивать объекты в условиях вождения с пониженным давлением воздуха. Отзыв написан 18 мая 2014 г. . Наши основатели создали репутацию службы и ценности, которая сохраняется во всей организации и сегодня. Speedy K может выполнять большинство наших услуг при температуре до 25 градусов по Фаренгейту. Тропа в основном используется для пеших прогулок, прогулок и поездок на природу. (1) 117 W. БЮЛЛЕТЕНЬ. Готовы проверить пятые колеса лично? Зайдите в наш дилерский центр в Эри, штат Пенсильвания, чтобы ознакомиться с огромным ассортиментом новых и подержанных седельно-сцепных устройств, выставленных на продажу.Не сейчас. Позвоните сейчас 1-800-232-0734 2022-1-24 · 06 f150 17-дюймовые стальные диски $100 (eri > Seneca pa ) pic скрыть эту публикацию восстановить восстановить эту публикацию. Новые объявления: Подержанный Ford Taurus SEL 2017 года на продажу, + НЕ ТРЕБУЕТСЯ КРЕДИТ ПЛОХОЙ КРЕДИТ ОК! Шины Колеса/Ободья (Эри, Пенсильвания) Ron’s Rims — это местное вымышленное имя в Пенсильвании, зарегистрированное 25 февраля 2002 года. Мы связаны с более чем 3000 переработчиков по всей территории США и … 814-920-7113. 4408 Peach St. AmericanListed предлагает безопасные и местные объявления обо всем, что вам нужно! Компания Dias Spring Service с полным спектром услуг по ремонту и техническому обслуживанию автомобилей и грузовиков удобно расположена по адресу 364 West 12th Street в Эри, штат Пенсильвания.ком для оперативного ответа. 350 долларов. Цена: 66 868 долларов. 17 октября 4 отзыва о шинном и автомобильном сервисном центре Johnson & Flick “Это был очень приятный опыт. B Страница 1 из 12 ZURN INDUSTRIES, LLC ♦ СПЕЦИФИКАЦИЯ РАБОТЫ ДРЕНАЖА ♦ 1801 Pittsburgh Ave. Просмотрите результаты поиска для дисков 350z Автомобильные запчасти для распродажа в Эри, Пенсильвания. 2022-1-21 · Veeva [NYSE: VEEV] — лидер в области облачного программного обеспечения для мировой индустрии наук о жизни.Заменяете ли вы поврежденное стальное колесо или хотите приобрести комплект зимних шин и колес. , у нас есть все для вас!Мы также предлагаем полную линейку OEM заводских колпаков для автомобилей иностранного и отечественного производства.цурн. управляется Ron & Dawn Bennett, с офисами в красивой северо-западной Пенсильвании и Месе, штат Аризона. Рекомендуемая производителем розничная цена: 77 332 доллара США. Suite 102 (напротив Перкинса) Эри, Пенсильвания 16509 ЗВОНИТЕ: (814) 452-6930 НЕТ ФАКСА: Пожалуйста, отсканируйте и отправьте электронное письмо по адресу [email protected] Однако в качестве свадебного подарка он подарил своей новой невесте большую комнату с… ЭРИ УИЛС. ШиныНОВЫЕ ШИНЫ НА ПРОДАЖУ В ERIE, PA. Эри, штат Пенсильвания Менеджер проекта Erie Insurance Group 2005 – 2008 3 года. Справка … ЕДА НА КОЛЕСАХ ERIE 4408 Peach Street.Процесс зацепления прост, и его можно выполнить без помощи другого человека. Мы отправляем по всему миру. SUZUKI KingQuad 750 AXi 2022 ГОДА, СВЕЖИЙ С ГРУЗОВИКА И ГОТОВ К НОВОМУ ДОМУ!! НЕ ЖДИТЕ ПОКА ОНИ УЙДУТ!! ОБЪЕДИНИТЕ ЛЕБЕДКУ И ПЛУГ ВСЕГО ЗА 950 ДОЛЛАРОВ США! ДЛЯ ПОДРОБНОЙ ИНФОРМАЦИИ ЗВОНИТЕ В ПРЕДСТАВИТЕЛЬСТВО RTE 8 814-825-2396 KingQuad 750AXi — это не просто новый квадроцикл, это квадроцикл KingQuad. На дне есть ямки в центре, но это не повлияет на работу кастрюли. Насколько я видел, в пределах 30-45 минут от Эри нет других мест для боулдеринга, кроме Панамских скал.2022-1-11 · 4 BMW X6 E71 Легкосплавные диски 19 дюймов Style 232 с TPM/шинами 36116774893/4. Получить котировки доставки Подать заявку на финансирование. Если вам интересно, где я могу купить колеса Chrome онлайн, вы нашли правильный источник! Будьте в курсе о Meals On Wheels Erie, новостях для пожилых людей и информации о опекунах. ФОТОГРАФИИ ОТКРЫТИЕ И НАЧАЛО ТОРГОВ Понедельник, 7 февраля, 10:06 $0 Лот #4613905 Store Space Erie Ave Philadelphia, PA 19140. При покупке новых шин у нас вы получите бесплатный пожизненный шиномонтаж, балансировку вращения, ремонт проколов, сход-развал. проверки, проверки давления, ротация шин и многое другое.Цены на Dodge Journeys в Эри в настоящее время варьируются от до, с пробегом автомобиля от до. Мы всегда стремимся заботиться о вас как о нашем клиенте; мы хотим быть единственным автомагазином в Эри, штат Пенсильвания, на который вы можете положиться. 2021-4-25 · 42 фотографии. Мы сэкономим ваше время, деньги и устраним неприятности, которые обычно возникают из-за погнутых или сломанных дисков. Основной адрес компании: 980 N Michigan Ave, Chicago PA-60. Статус регистрации компании указан как «Активный», а номер ее файла — 3319913. com ) pic скрыть эту публикацию восстановить восстановить эту публикацию 2022-1-23 · Пенсильвания имеет строгие законы в зависимости от материала, который вы продаете.Викторианская принцесса — это настоящая гребная лодка, курсирующая по красивому заливу Преск-Айл с мая по октябрь. 2021-4-1 · Город Эри вновь открывает парки и детские площадки с вывесками с рекомендациями по COVID-19. 2019-12-19 · Подержанный Ford F-150 2015 года, от Champion Ford Sales в Эри, Пенсильвания, 16506. 675 долларов (Рестон, северная Вирджиния) фото скрыть эту публикацию восстановить восстановить эту публикацию. Веб-сайт. Brotherson 4959 Волчья дорога Эри, PA 16505 ИНН. Сообщество Просмотреть все. Покупка . Другие программы доставки еды на дом в округе Эри, которые напрямую не поддерживаются Департаментом обслуживания пожилых людей.Просмотрите результаты поиска дисков для автомобилей, выставленных на продажу в Эри, Пенсильвания. Выбирайте из целого ряда цветов, причем оттенки черного и серебристого до хромового очень популярны. 200 долларов. Меню и бронирование У них есть мои зимние шины и диски. Presque Isle Auto Paint & Collision. Во-первых, важно, чтобы вы знали, что склад металлолома обязан вести учет сделки. OfferUp Звоните по телефону (814) 676-5721 или пишите нам по адресу [email protected] 3. Филадельфия. ДЕТАЛИ. 140 2015-1-6 · Кафе «Рим»: очень-очень интересно: 46 отзывов путешественников, 45 откровенных фотографий и отличные предложения для Филадельфии, штат Пенсильвания, на Tripadvisor.9-я коллекция мероприятий, состоявшаяся в City of Corry Garage, 650 E. (814) 453-4669. (814) 520-8163. com $9,999 (Звоните📞1(800)220-9683 🏍🏍🏍Веб-сайт: wantoldmotorcycles. В AmericanListed представлены безопасные и местные объявления для всего, что вам нужно! Автомобили и грузовики на продажу в Эри, Пенсильвания: Honda Accord EX L 2018 года, Honda Accord LX 2019 года , Honda CR V LX 2019 г., Chevrolet Trax LT 2018 г., Качественные шины и автозапчасти 2019 г. в Эри, Пенсильвания. Продал джип, и у меня уже есть комплект для другого моего джипа. Звоните сейчас. Arctic Cat Alterra 600 EPS Schutt’s Saw & Mower 2022 г. – 42 мили.прочь. (814) 453-2021. 1172 S 9th St, Philadelphia, PA 19147-4631 (Bella Vista / Queen Village) +1 215-465-3515. ТА. Также мы предоставляем услуги эвакуатора. 2022-1-22 · ШИНЫ И ДИСКИ ДЛЯ ТРАКТОРОВ И ПОГРУЗЧИКОВ 16. Поиск из 10 подержанных автомобилей Audi Q5 на продажу, включая установленные и отбалансированные на 15-дюймовых американских гоночных дисках. но использовались на Jeep Wrangler 94 года выпуска. com ) pic скрыть эту публикацию восстановить восстановить эту публикацию 1. Ken-Ton Meals on Wheels – (716) 874-3595.Dias Spring Service в Эри, штат Пенсильвания, является вашим местным специалистом по регулировке полноприводных автомобилей. Запутанным образом с момента первого внесения в 2010 году поправка в последнюю минуту была внесена представителем Кевином Шрайбером (D-95) с идентичным … Эри, Пенсильвания – Продажа квадроциклов – Торговец квадроциклами. Заказать онлайн. разыскиваются старые мотоциклы. 16 января 1990 г.   ·  lima-findlay для продажи «дисков и шин» – Craigslist Пенсильвания сообщает о 18 955 новых случаях коронавируса, 269 дополнительных смертях; В округе Эри зарегистрировано еще 333 случая По всему штату госпитализировано 6794 (-168) человек с COVID-19, из них 1106 (-10) пациентов находятся в отделении интенсивной терапии.добавить в избранное этот пост Янв 23 Отличная подержанная форма ШИНЫ $35 (eri > Erie pa ) pic скрыть эту публикацию восстановить восстановить эту публикацию. RIM DOCTOR INC. Вице-президент Bauer по специализированному / среднему рынку в Erie Insurance Group Fairview, Пенсильвания, США Более 500 подключений 2022-1-23 · cleveland вездеходы, вездеходы, снегоходы – craigslist 2021-4-26 · Oliver’s Rooftop. 55 миль) Эри, Пенсильвания, Пенсильвания 16509. ” В 4 отзывах. Этот земельный участок доступен для продажи. Зарегистрирован: 29 марта 2011 г. Факс: (610)837-8967 – Всего 78280 миль! -3.Посетите сайт. Эта страница посвящена автомобильным шинам. 2021 MAHINDRA 1635 35HP, 4WD, Shuttle Trans, погрузчик, 7 лет гарантии. Мой Jeep Compass 2011 года нуждался в замене масла, и я боялся иметь дело с ожиданием моей машины и переплатой за работу. Относится к категории Футболки с принтом на заказ. Обзор Программа Meals on Wheels of Erie County, более известная как GECAC Meals on Wheels, преследует единственную цель — помочь нашим пожилым соседям продлить свою независимость и здоровье по мере старения.Мы можем отрегулировать двойное рулевое управление, несколько задних осей, а также подъемные и вспомогательные оси. *** совершенно новый lexus rx330 rx350 rx400h 2004–2009 17-дюймовый обод колеса oem 70 долларов (ДЖОНСТАУН) фото скрыть эту публикацию восстановить восстановить эту публикацию в избранное это сообщение 10 января Сэкономьте до 10 200 долларов на одном из 651 подержанных Dodge Charger в Эри, штат Пенсильвания. Зарезервировать столик Боулдеринг недалеко от Эри, Пенсильвания ( Северная Америка: США: Пенсильвания) Пожаловаться на эту публикацию Среднее число: (0 оценок) Не могу опубликовать Мы предлагаем широкий выбор марок и размеров шин, чтобы удовлетворить конкретные потребности и предпочтения каждого клиента.2022-1-19 · Ободья Chevy/GMC Steel 6 с выступами Шины Goodyear Wrangler (размер P265/75R16) $125 (Piscataway ) pic скрыть эту публикацию восстановить восстановить эту публикацию. Н. www. $140 (Erie pa ) pic скрыть эту публикацию восстановить восстановить эту публикацию. 2629 Buffalo Road Erie, PA 16510 (814) 899-2265 Подробная информация о магазине. 2022 Filmore Avenue Warehouse # 26 Erie, PA 16506. com $9,999 (ЗВОНИТЕ📞(800)220-9683 🏍🏍🏍🏍🏍Веб-сайт: wantoldmotorcycles. Посмотрите все наши бренды колес ниже и совершите покупки в Эри, Пенсильвания, США. # 33- 6-19-108 р.5 х 5 . Автомобили, выпущенные 12-6-2021 или позже, будут вынуждены включать (00G) Не оборудовано подогревом рулевого колеса, что убирает подогрев рулевого колеса. VIN: 1FTEW1E86FFB58714 2021-2-15 · 66 Реальные отзывы клиентов о Ras Auto Body, Inc. Если вашему автомобилю требуется ремонт кузова, ознакомьтесь с Ras Auto Body, Inc с реальными рейтингами и отзывами в Эри, Пенсильвания, 16502 2020-3- 14 · 0 Station Rd, Erie, PA 16510. Подпишитесь, чтобы получать наш информационный бюллетень «Пища для размышлений» здесь. +1 814-920-9666. является корпорацией внутреннего бизнеса Пенсильвании, зарегистрированной 11 июля 2005 г.Verve 2 Disc — это гибридный велосипед, созданный для комфорта и удовольствия в поездках на работу, круизах и фитнес-заездах. Эри, Пенсильвания 16501. 814-208-7009. 98586 Rev. Не пропустите, что происходит в вашем районе. 2147 Западная 12-я улица. Автозапчасти Эри 1 $ Посмотреть фотографии. Информационные бюллетени Meals On Wheels Erie 2021-11-18T18:36:47+00:00. Kerr’s Tire Korner является лидером в предоставлении шин, колес и услуг по ремонту автомобилей известных брендов для клиентов в Эри, Пенсильвания, Фэрвью, Пенсильвания, Северо-Востоке, Пенсильвания и прилегающих районах. В Tyres for Less мы стремимся предоставить нашим клиентам самый большой выбор качественных шин и автозапчастей в Эри, штат Пенсильвания, и его окрестностях.org Эри, Пенсильвания 16509 (814) 452-6930. Смит-стрит, Корри, Пенсильвания ** 12 июня Сбор мероприятий, проведенный в здании технического обслуживания округа Альбион, 2008-2-7 · 1 ответов о «Подключении автомобильного кузова в Эри-Па» Onpkcah сказал: 7 февраля 2008 г., 22:3. Мы семья, которая действительно разбирается в шинах и авто 2022-1-19 · erie, PA (eri) finger lakes, NY (fgl) flint, MI (fnt) fort wayne, IN (fwa) frederick, MD (fdk) fredericksburg , VA (ezf) greensboro, NC (gbo) harrisburg, PA (hrs) Диски Devino – GM 6 выступов 17×9 дюймов Грузовые диски – черные с разделенными полосами 300 долларов США (Murrysville PA) скрыть эту публикацию восстановить восстановить эту публикацию.gov Найдите колеса Rtx в Эри, штат Пенсильвания. с 8:00 до 16:00 в рабочие дни. 452. Директор — Дэниел М. Хартли из Фэйрвью, Пенсильвания. «Велосипеды Electric-Assist теперь разрешены на дорогах Пенсильвании в соответствии с Законом 154. 500 долларов (Эри, Пенсильвания) фото скрыть эту публикацию восстановить восстановить эту публикацию. Познакомьтесь с регионом Эри и нашим сообществом с помощью изображений из ланкастерской газеты Erie Times. , PA (lns) lansing, MI (lan) lehigh Valley (alt) lima / findlay (lma) mansfield, OH (mfd) meadville, PA (mdv) monroe, MI (mnr) morgantown, WV (wvu) нью-йорк ( nyc) северный джерси (njy) северный мичиган (nmi) северный панхандл (whl) онеонта, штат Нью-Йорк (onh) паркерсберг-мариетта (pkb) филадельфия (phi) питтсбург, Пенсильвания (pit) poconos (poc Auto Wheels Wholesale in Erie on superpages.добавить в избранное этот пост 13 декабря Эри (Западная 12-я улица) Рейтинг местоположения: На основе 901 отзыва. Сэкономьте до 5 474 долларов на одном из 442 подержанных Dodge Journeys в Эри, штат Пенсильвания. Премиум. Красивый район. В World of Wheels мы также обслуживаем бренды, которые продаем другим. Мы используем песок, стеклянные бусины, стальной песок и соду. 9099 долларов. 35 долларов. Тропа протяженностью 6 миль в обе стороны, расположенная недалеко от Брэдфорда, штат Пенсильвания, с рекой и оценивается как умеренная. 19.01.2022 · Балтимор на продажу «диски» – craigslist 19.01.2022 · От Эри до гор Поконо северная часть Пенсильвании представляет собой сельскую местность и иногда является забытой территорией для посетителей штата Кистоун.Тем не менее, я смог зайти на веб-сайт Johnson & Flick, чтобы получить расценки на услуги, и они ответили мне по электронной почте в течение часа. Стремясь к инновациям, совершенству продукции и успеху клиентов, наши клиенты варьируются от крупнейших мировых фармацевтических компаний до новых биотехнологических компаний. Meals on Wheels Erie стремится поддерживать вашу уверенность и доверие в отношении конфиденциальности вашей личной информации. 2022-1-17 · дней назад Эри, Пенсильвания Предлагается продажа квадроциклов 814-825-2396. До 11.2022 Suzuki KingQuad 750 AXi Off-Road Express Route 8 – 4 мили. Колеса Авторемонт и обслуживание Развал-схождение-рама и ось… 2 новые зимние шины 205-65-15 на колесах Malibu 5×110 97-12 $140 (Erie pa ) pic скрыть эту публикацию восстановить восстановить эту публикацию. Выравнивание тяжелых грузовых автомобилей, автобусов, домов на колесах и прицепов. Просмотрите результаты поиска по колесным дискам audi Автомобили, выставленные на продажу в Эри, Пенсильвания. 7286 Penn Drive, Bath PA 18014. Он погружается еще глубже в 2021-12-20 ·  Стремясь сократить количество свалок отработанных шин в штате, правительство Пенсильвании создало и профинансировало инициативу по переработке шин в масштабах всего Содружества.принадлежит и управляется Ron & Dawn Bennett, офисы компании расположены недалеко от озера Эри в Фэрвью, штат Пенсильвания. Нет. Ваш местный дилер Cooper Tire в Эри, штат Пенсильвания. Добро пожаловать в Best Used Trucks of PA. Местоположение: Vandling PA 2022-1-23 · добавьте эту публикацию в избранное 22 января 2005 г. Chevrolet Avalanche 1500 5dr Crew Cab 130 в WB 4WD Z71 7 495 долларов США (2005 Chevrolet Avalanche 1500 5dr Crew Cab 130 в округе WB 4WD окленд) pic скрыть эту публикацию восстановить это публикация 2021-2-24 · Игроки баскетбольной команды Erie High Boys не дожили до просмотра Phi Slama Jama Университета Хьюстона в 1980-х годах.75 долларов. Новые объявления: ДЛЯ ПРОДАЖИ-2-17″CHEVY WHEELS/TPM – $110 (CAMBRIDGE SPRINGS PA. 1260 eam nбетонная стена земли в настоящее время или ранее принадлежат albert p. com В Канаде: ZURN INDUSTRIES LIMITED ♦ 3544 Nashua Drive ♦ Mississauga, Ontario L4V1L2 ♦ Телефон: 905\405 … 2021-1-13 · Только для жителей округа Эри. Относится к категории шинных магазинов. image 1 из 12. Как далеко отсюда до аэропорта. org ЧАСЫ: с 8:00 до 16:00 с понедельника по пятницу Венди Уоллес Исполнительный директор [email protected] Best Used Trucks of PA работает в бизнесе более 15 лет.00-24, 18-34. Телефон: (814) 453-4488. Он имеет множество продуманных функций, которые обеспечивают уверенную и комфортную езду, например, подседельный штырь с подвеской, мягкое седло и дисковые тормоза, работающие в любую погоду. Новые объявления: Подержанный Ford Taurus SEL 2017 года на продажу, + НЕ ТРЕБУЕТСЯ КРЕДИТ ПЛОХОЙ КРЕДИТ ОК! Шины Колеса/Диски (Erie PA) Просмотр результатов поиска дисков 15 Автозапчасти для продажи в Erie, PA. Ю. Надеюсь, что они еще работают или хотя бы вернут мое снаряжение. World of Wheels — 2572 State Rt 257 — Seneca, PA 16346.НЕДАВНИЕ ПОСТЫ. б. 00. МИККИ ТОМПСОН БОЛЬШОЙ БУББА 3197 35/15 X 16 НА ДВОЙНЫХ ЗАМКАХ SANDERS 16 X 16-7/8 С ВОЗВРАТОМ 6 1/4. Мы предоставляем поддержку, инвентарь и ресурсы, необходимые для сокращения времени простоя и увеличения производительности. Обработайте герметиком для колесных дисков, если они покрыты хромом: Промойте кузов грузовика под давлением, если есть: Очистите и обработайте кожаные сиденья, если есть: Удалите легкую тормозную пыль, дорожную смолу или дорожную грязь* Очистите центральную консоль, чтобы удалить легкие пятна: Обработайте снаружи пластиковая отделка: пыльная отделка салона Лучшие цены на 15-дюймовые диски и диски — в Discount Tire.Мы стремимся к совершенству и стремимся использовать только самые современные технологии. $0 (STANTON MI ) фото скрыть эту публикацию восстановить восстановить эту публикацию. 20 долларов. 2021-1-17 · добавьте этот пост в избранное 4 января Требуются старые мотоциклы 📞1(800) 220-9683 www. Колеса Выравнивание колес – Обслуживание рамы и мостов – Автомобилестроение… Полное обслуживание автомобилей Firestone. C&J Automotive Performance 2802 Glenwood Park Ave … Загляните в Byrider – PA103, 4125 Peach Street, Erie, PA 16509, чтобы получить свой Ford Escape! С турбонаддувом, Передний привод, Усилитель руля, ABS, Дисковые тормоза на 4 колеса, Алюминиевые диски, Шины – передние характеристики, Шины – задние характеристики, Временное запасное колесо, Задний спойлер, Автоматические фары, Противотуманные фары, Подогрев зеркал, Электропривод идеально, я очень впечатлен ими.29.10.2014 Тамра К. 6-литровый двигатель VVT V6 с гибким топливом, 3. Спасибо, что доставили их так быстро. Позвоните нам сегодня, чтобы получить дополнительную информацию о 2021-11-30 · Свяжитесь с дилером коммерческих шин Firestone в Эри, штат Пенсильвания, чтобы купить сельскохозяйственные шины и гусеницы, внедорожные шины, а также шины для грузовиков и автобусов. Ron’s Rims — это местное вымышленное имя в Пенсильвании, зарегистрированное 25 февраля 2002 года. Найдите свой идеальный автомобиль с помощью экспертных обзоров Edmunds, инструментов сравнения автомобилей и инструментов ценообразования. За этим следят 573 человека. Узнайте, как вы можете претендовать на эти бесплатные обеды.Flynn’s Tire Company — это семейный бизнес, которым управляет семья Флиннов в округе Мерсер, штат Пенсильвания. 685, с. Найдите Rim 21 P в Эри, штат Пенсильвания. добавить в избранное этот пост 17 января Новые и подержанные диски для продажи в Эри, штат Пенсильвания, на Facebook Marketplace. Плата за электронику 50 фунтов за фунт. Лэрд был так впечатлен этой пряжей, что женился на девушке. AmericanListed предлагает безопасные и местные объявления для всего, что вам нужно! Найдите Taurus Wheels в Эри, штат Пенсильвания. Просмотрите результаты поиска легкосплавных дисков Автомобили для продажи в Эри, Пенсильвания.Пишите по электронной почте или звоните по телефону 1-800-901-6003. У Jay’s есть несколько сервисных центров, где можно найти запчасти, которые трудно найти, в случае, если у Jay’s нет вашей запчасти на складе. Популярные запросы: 2022-1-18  · Union City, Pennsylvania 16438. & linda l. Мы изучили законы, регулирующие куплю-продажу металлолома в Пенсильвании, и резюмировали главное, что вам следует знать. Food For Thought — это наш ежемесячный информационный бюллетень для волонтеров и друзей Meals On Wheels Erie.добавьте этот пост в избранное 14 декабря. ]) 1853-1859, 20 октября 1855 г., изображение 3, предоставлено вам библиотеками Университета штата Пенсильвания; Университетский парк, … Попробуйте наш двойной черный бриллиант – фирменный мартини в ресторане Firebirds Wood Fired Grill – или один из наших сезонных авторских коктейлей! Посмотреть меню коктейлей. Rim Doctor Inc. В 19 милях от Эри, штат Пенсильвания. Эри, Пенсильвания. Преодолевайте самую сложную местность на Земле с усовершенствованным составом Krawl-TEK, который улучшает сцепление на каменистых и скользких поверхностях, повышая сцепление с дорогой на 8 % (2). Был очень жаркий и влажный день, когда мы были там, поднялись по ступенькам между скалами к нижней тропе, есть место, где очень холодный воздух проходит сквозь скалы, и это было потрясающе.Это номер 9 и диаметр 11 дюймов. Последние новости По данным Совета по доступу к велосипедам штата Пенсильвания, велосипеды Electric-Assist теперь разрешены на дорогах Пенсильвании в соответствии с Законом 154. 150 долларов. Вы можете заработать 10-40% от любого Детальный пакет, когда транспортное средство или оборудование для отдыха обслуживаются на регулярной основе.Эта технология в сочетании с нашим 70-летним опытом сделала нас ведущей автомобильной ремонтной мастерской в ​​Эри. Просмотрите списки шин и колес рядом с Эри, штат Пенсильвания. 2-8 БОЛТОВЫЕ КОЛЕСА FORD С 6 ОТВЕРСТИЯМИ – 100 долларов США (cambridgesprings pa) myec.7500 долларов. 8399 долларов. Посетите демонстрационный зал › GECAC Meals on Wheels ежегодно готовит и доставляет более 100 000 бесплатных обедов пожилым людям в городе Эри и округе Эри. $200 (ПИТТСБУРГ) фото скрыть эту публикацию восстановить восстановить эту публикацию. Справка… Amherst Meals on Wheels — (716) 636-3065 обслуживает Западный и Восточный Амхерст, Эггертсвилль, Снайдер и Уильямсвилль. У меня сложилось впечатление, что у меня, вероятно, проблема с шинами, поэтому я оставил машину… 2022-1-20 · 2006-2010 JDM EJ25 AVLS 2. Western PA News Округ Эри планирует еще две клиники экспресс-тестирования на COVID в конференц-центре Bayfront 2022- 1-24 · 20-дюймовые колеса STR, расположенные в шахматном порядке, 607 Candy Gold, глубоко вогнутые диски ETC133-2 $1899.Для тех, кто хочет испытать новые гастрономические впечатления, энергичные счастливые часы или семейный пикник, и все это во время … Виртуальный тур. & Дороти А. Если мне когда-нибудь понадобится комплект колес, я знаю, где искать. 29.10.2017 · Форма № FD61 Дата: 03.06.08 C. 2700 долларов. Станции и услуги по техосмотру автомобилей Глушители и … Комплексный уход за автомобилем Firestone. Диски – Объявления в Эри, Пенсильвания: ДИСКИ 4 01 05 Pontiac, СНЕЖНЫЕ ШИНЫ 4 Grabber Arctic, AUTO RIM Никогда не использовались 16×6, ЗАПАСНОЕ КОЛЕСО Универсальное временное Найти 2 колеса в Эри, Пенсильвания.40 долларов. 458 174. Посмотрите трейлеры и узнайте больше. Эри, Пенсильвания, США. Интересный. Еще один источник, который можно использовать для материала, о котором я упоминал выше. 2022-1-22 · добавьте этот пост в избранное 7 января Требуются старые мотоциклы 📞1(800) 220-9683 www. 814-208-7005. Видеочат с продавцом электронной почты. Мы также используем инженерные электронные измерительные системы Hunter для получения быстрых и точных результатов центровки. 2. 3 отзыва. 6. 1. По состоянию на 2010 год Содружество очистило 27. 163 East 10th St. com ) pic скрыть эту публикацию восстановить восстановить эту публикацию Подержанный Jeep Grand Cherokee 2015 года, от Champion Ford Sales в Эри, Пенсильвания, 16506.Развал-схождение нескольких осей — одна из наших специализаций. Мы предлагаем полный спектр услуг по ремонту и обслуживанию автомобилей, а также тюнинг и кузовные работы. PA Hydrographics — семейный бизнес, базирующийся в Эри, штат Пенсильвания. Если вы за рулем, вы сможете воспользоваться ближайшей парковкой. Групповая пескоструйная обработка в Эри в Advanced Metal Fabrication & Finishing. ТУРИСТИЧЕСКИЕ ЦЕНТРЫ АМЕРИКИ. Шины 8 x 12 с дисками, коробки, сумки, искусственные растения, ящики для инструментов, сумки для книг, сумки, разные предметы, мебель, кроссовки Nike, кошелек Louis Vuitton Lot # 4613904 Store Space Erie Ave Philadelphia, PA 19140.Закажите доставку еды. 2 новые зимние шины 205-65-15 на колесах 5×110 97-12 Malibu $140 (Erie pa ) фото скрыть эту публикацию восстановить восстановить эту публикацию. 09 передаточное число (REQ: двигатель ERB), масляный радиатор двигателя, реечное рулевое управление с электроприводом, откидной пуск, складывающиеся зеркала с электроприводом, зеркала с подогревом, дверные ручки в цвет кузова, активные подголовники, кожаный руль, управление аудиосистемой на рулевом колесе, автомобиль Компания Flynn’s Tire and Auto Service предлагает шины, диски и автосервисные центры в штатах Огайо и Пенсильвания, «где рекламируемая цена является полной ценой», а также грузовые шины и услуги для клиентов автопарка через свое коммерческое подразделение.3259 4 отзыва о Flynn’s Tire & Auto Service «Могу ли я просто сказать, что эти ребята спасли наш отпуск!!! Спасибо Джеффу Наю и всей вашей команде за отличный сервис… Хабетро, ​​сжалившись над девушкой, согласился прясть лен для лэрд, чтобы девушка могла притвориться, что это от нее. 35-дюймовые шины на 17-дюймовых дисках. com Не стесняйтесь звонить (814) 676-5721 или писать нам по электронной почте [email protected] добавить в избранное этот пост 15 января Полный комплект колес Toyota с шинами – радиальные колеса Dunlop AT20 – OEM 27-дюймовые ободья для шоссейного велосипеда 650c 20 долларов США!!! – 20 долларов США (северо-восток) Я недавно купил велосипед Schwinn Sprint 1980-х годов и разделил его, чтобы продать по частям.3259. Крыша Оливера. Сервис – это разница. Охватывая северные графства, дорога содержит множество захватывающих достопримечательностей и живописных видов, которые вы не захотите пропустить. 534 людям нравится это. Здесь, в First Amendment Tees Company, МЫ ПРЕДЛАГАЕМ футболки, толстовки, куртки, печать на одежде, виниловые трансферы, термотрансферы, наклейки, шелкографию, вышивку, индивидуальный дизайн логотипа, рекламную продукцию, команду 2021-6-26 · Еженедельник Erie наблюдатель. Меню и … Erie News Now: освещение, на которое можно положиться .Ученые открывают Ураган Ида Купить сейчас Беги и езжай Очистить название Аукцион сегодня Аукцион завтра Аукционы по времени Доступны публике Поездки мечты Прокат аттракционов Специальность Виртуальная дорожка На этой неделе На следующей неделе Просмотрите результаты поиска игрушек для лошадей Автомобили, выставленные на продажу в Эри, Пенсильвания. ) скрыть эту публикацию восстановить восстановить эту публикацию в избранное эту публикацию 17 января 2022-1-18 · 🚘 Super Deal -17 18 20 22 Fuel Off Road диски обода $1,248 (yng > Мгновенное одобрение не требуется) pic скрыть эту публикацию восстановить восстановить эту публикацию 9 900 долларов 3 отзыва о шинах за меньшие деньги «Раз в неделю я еду в Эри по работе, и примерно на полпути моя машина начала трястись, как будто произошло землетрясение, ну, землетрясения не было.17 заездов. Переработка шин обойдется в 5 долларов. ДВИГАТЕЛЬ 6L VVT V6 FLEX-FUEL, ЛЮК КРЫШИ PWR -3. Обратитесь к дилеру для получения подробной информации или на этикетке окна для получения информации о функциях конкретного автомобиля. 5/10. избранное в этом посте 14 января. Я установил четыре … Мобильная библиотека, которая находится на раме автомобиля Ford E450 2021 года, регулярно посещает более 30 мест по всему округу Эри. Эри, штат Пенсильвания, руководитель проекта RIMS, общество управления рисками – InsurTech World 2021-9-7 · Дэн Керн, новое место в West Erie Plaza под названием Bar Ronin; зона барбекю с лицензией; Triple D пытается запечатлеть поздний вечер с фургоном с едой; Приближается спорт-бар Harborcreek.2021-7-7 · Когда они изнашиваются и приходит время их заменить, вы можете найти широкий выбор всесезонных, зимних, вездеходных и внедорожных шин в своем супермаркете Erie Supercenter Walmart. Pac on Autoxray code В Канаде, Европе, … 2020-5-14 · Удобства City of Erie Park. Дэн Керн, совладелец 2147 West 12th Street. Чтобы узнать, чем мы занимаемся, загрузите самый последний выпуск или любой из наших прошлых выпусков ниже. Тел.: (814) 520-5421 Факс: (814) 403-4185 Часы работы: Пн-Пт: 8:00 – 16:30. См. цены Kelley Blue Book, чтобы получить лучшее предложение.$875 (Эри ) фото скрыть эту публикацию восстановить восстановить эту публикацию. Если вы ищете новый комплект шин, вы можете прийти посмотреть, что у нас есть… Купить изготовленные на заказ колеса, диски, шины, решетки и многое другое в Пенсильвании, США. 4050 Депо Роуд. Этот садовый трактор оснащен двигателем Kohler мощностью 14 лошадиных сил и полностью гидростатической трансмиссией. $2,045 (JDM ENGINE VIRGINIA 4262-V ENTRE CT CHANTILLY VA 20151 округ Колумбия) фото скрыть эту публикацию восстановить восстановить эту публикацию. 2021-12-2 · erie, pa 16505 588 для озера erie 577.Участок под застройку площадью 43 акра, расположенный на съезде к Майклу Дж. 2022-1-24 · 170 долларов США (eri > Erie pa ) pic скрыть эту публикацию восстановить восстановить эту публикацию. У некоторых есть оттенок цвета, например, красные блики. Эри, Пенсильвания 16509 (814) 452-6930. ♦ Erie, PA 16514 Тел.: 814\455-0921 ♦ Факс: 814\454-7929 ♦ World Wide Web: www. Закажите онлайн и установите их в одном из наших 1000+ мест. Erie PA 16505. Позвоните по телефону 814-899-9667 или зайдите! СТАЛЬНЫЕ ДИСКИ ОЕМ. Эри (Западная 12-я улица) 2419 Западная 12-я улица, Эри, Пенсильвания 16505.2021-7-13 · Когда они изнашиваются и приходит время их заменить, вы можете найти широкий выбор всесезонных, зимних, вездеходных и внедорожных шин в вашем супермаркете Erie Supercenter Walmart. В наличии. УДАЛЕННЫЕ КОЛЛЕКЦИИ: * &Apr. Абразивоструйные и покрасочные работы в Харборкрике, Пенсильвания. Добавить в избранное этот пост 19 января. Kerr’s Tire Korner Посмотреть на карте. . О нас/Часто задаваемые вопросы; Реклама; Команда новостей; Контакт; Политика конфиденциальности; Условия эксплуатации; FCC Filing/EEO 2017-10-29 · Форма № FD61 Дата: 03.06.08 C. 14. com вы найдете множество пакетов колес и шин, нестандартные бренды дисков, такие как колеса American Force, колеса Moto Metal, колеса Fuel или Более 70 других ведущих брендов.Улучшите этот список. “ У них также есть Subway & Pizza Hut, где можно выбрать еду, помимо ресторана Country Pride.